Overview

Comprehensive Description

Biology

Benthic in coral reefs (Ref. 58302). Solitary and secretive, among corals (Ref 90102).
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to French Polynesia. Recently reported from Ouvéa Atoll, Loyalty Islands (Ref. 13236).
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa east to Hawaiian and Society Islands, south to Loyalty Islands (New Caledonia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 8; Analspines: 3; Analsoft rays: 5
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

10.5 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

With vertical scale rows in low 40's; suborbital ridge with 3 spinous points in a single row; interorbital spines absent or present as a lump; small spines at midline between tympanic spines present (Ref. 10482).Description: Characterized by reddish-brown to brown color with numerous small white flecks; across caudal peduncle, white bar; above pectoral-fin base to middle of spinous dorsal fin with pale band; pectoral fin base with triangular brown band; strongly projecting lower jaw; depth of body about 2.7 in SL (Ref 90102).
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 18 m (Ref. 10482)
  • Eschmeyer, W.N. and J.E. Randall 1975 The scorpaenid fishes of the Hawaiian Islands, including new species and new records (Pisces: Scorpaenidae). Proc. Calif. Acad. Sci. 40(11):265-334. (Ref. 10482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.915 - 9.9125
  Temperature range (°C): 25.428 - 25.778
  Nitrate (umol/L): 0.073 - 0.088
  Salinity (PPS): 34.712 - 35.264
  Oxygen (ml/l): 4.802 - 4.945
  Phosphate (umol/l): 0.166 - 0.238
  Silicate (umol/l): 0.910 - 1.493

Graphical representation

Depth range (m): 0.915 - 9.9125

Temperature range (°C): 25.428 - 25.778

Nitrate (umol/L): 0.073 - 0.088

Salinity (PPS): 34.712 - 35.264

Oxygen (ml/l): 4.802 - 4.945

Phosphate (umol/l): 0.166 - 0.238

Silicate (umol/l): 0.910 - 1.493
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 18m.
Recorded at 18 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenodes corallinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCCGGCATGGTAGGCACAGCATTAAGCCTGCTGATCCGAGCAGAACTGAGCCAACCAGGTGCCCTCCTGGGAGATGACCAGATTTATAATGTAATTGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTGGTTCCATTAATGATTGGCGCACCTGATATAGCCTTTCCTCGTATAAATAACATAAGCTTCTGACTTCTCCCACCCTCCTTCCTTCTTCTTCTGGCTTCTTCAGGCGTAGAAGCAGGTGCTGGTACCGGATGGACGGTCTACCCTCCTCTAGCTGGCAACCTCGCCCACGCTGGGGCATCCGTAGACCTAACAATTTTTTCTCTTCACCTAGCGGGGATTTCTTCAATTCTAGGTGCAATTAATTTTATTACCACAATTATTAACATAAAACCTCCGGCGATCTCCCAGTACCAAACACCCCTGTTTGTATGGGCCGTCTTAATTACCGCCGTACTTCTTCTGCTCTCCCTGCCTGTTCTCGCCGCTGGTATTACAATACTTCTAACGGATCGAAACCTCAATACTACTTTCTTTGATCCCGCAGGAGGAGGGGACCCGATCCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenodes corallinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!