Overview

Brief Summary

Macrocypraea cervus, the Atlantic Deer Cowrie, is a species of sea snail mainly distributed in the tropical Atlantic Ocean and in the Caribbean Sea, in the waters along South Carolina, Florida, Mexico, Brazil, Cuba and Bermudas. This cowry is elongated, its basic colour is light brown, with small whitish ocellated spots on the dorsum. The mantle of the living cowries is dark greyish and completely covered by short fringes. This species can mainly be encountered under corals and rocks in shallow waters. They feed on algae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 33 - 33
  Temperature range (°C): 23.384 - 23.384
  Nitrate (umol/L): 1.004 - 1.004
  Salinity (PPS): 36.162 - 36.162
  Oxygen (ml/l): 4.675 - 4.675
  Phosphate (umol/l): 0.138 - 0.138
  Silicate (umol/l): 0.942 - 0.942
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Macrocypraea cervus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCAGGTTTAGTTGGGACAGCCCTTAGTCTATTAATTCGAGCGGAGCTAGGACAACCAGGAGCTCTTTTAGGAGAT---GACCAATTATATAATGTAATTGTAACAGCTCATGCATTTGTTATAATTTTCTTTCTGGTCATACCTATAATGATTGGTGGGTTTGGAAACTGACTTGTCCCCCTGATATTAGGAGCTCCAGATATAGCCTTTCCTCGTCTAAATAATATGAGTTTTTGACTTCTGCCTCCAGCTTTGCTACTCCTTCTTTCTTCCGCGGCCGTTGAAAGGGGAGTTGGGACGGGATGAACAGTTTATCCTCCCTTAGCCGGTAATCTTGCACATGCTGGGGGGTCTGTTGATCTAGCTATTTTTTCGTTACATCTCGCTGGTGTTTCTTCTATTTTAGGTGCTGTAAATTTTATTACAACAATCATTAATATACGATGACGAGGTATGCAATTTGAGCGGCTTCCATTATTCGTTTGATCAGTAAAAATTACTGCAGTTCTTCTTCTTCTTTCTTTACCTGTTTTGGCTGGAGCCATTACAATATTGTTAACTGATCGAAATTTTAACACTGCTTTTTTTGATCCAGCGGGGGGTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Macrocypraea cervus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Macrocypraea cervus

Macrocypraea cervus, common name the Atlantic deer cowry, is a species of large sea snail, a very large cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Distribution[edit]

This species is mainly distributed in the tropical Atlantic Ocean including the Caribbean Sea, and in the waters off South Carolina, Florida, Mexico, Brazil, Cuba and the Bermudas.

Description[edit]

Giant Macrocypraea cervus – Florida

This species is one of the largest cowries. It is quite similar in shape and colour to Macrocypraea cervinetta, but it is much larger. The maximum recorded shell length is 190 millimetres (7.5 in), while minimum length is about 40 millimetres (1.6 in).

The shell is elongated, its basic colour is light brown, with small whitish ocellated spots on the dorsum, like a young fawn (hence the Latin name cervus, meaning 'deer'). Juveniles have no spots. The dorsum also shows a few transverse clearer bands, and a longitudinal line where the two edges of the mantle meet. The apertural teeth are dark brown. The mantle of the living cowry is dark greyish and completely covered in short fringes.

Habitat[edit]

Living cowries can mainly be encountered under corals and rocks in shallow waters at a maximum depth of 35 m. They feed on algae.

References[edit]

  • Welch J. J. (2010) - "The “Island Rule” and Deep-Sea Gastropods: Re-Examining the Evidence" - Simon Joly, McGill University, Canada
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!