Articles on this page are available in 2 other languages: German (1), French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

3 subspecies

Taxonomic history

Wheeler & Wheeler, 1953a PDF: 119 (l.); Formicidae). Experientia (Basel) 21:323-325. [1965-06-15]">Hauschteck, 1965 PDF: 325 (k.); Wasmann, 1891a PDF: 298 (gynandromorph).
Senior synonym of Myrmica pilosiscapus: Kutter, 1977c: 69; Collingwood, 1979 PDF: 55; Seifert, 1988b: 27; Casevitz-Weulersse, 1990a: 137; of Myrmica rugulosoides: Bernard, 1967a PDF: 116; Banert & Pisarski, 1972 PDF: 350; Collingwood, 1979 PDF: 55; Myrmica scabrinodis Nylander, 1846. Abhandlungen und Berichte des Naturkundemuseums Görlitz 58(6):1-8. [1984-11-30]">Seifert, 1984b PDF: 1; of Myrmica reticulata: Seifert, 1988b: 27; of Myrmica scabrinodosabuleti: Radchenko & Elmes, 2010: 259; of Myrmica symbiotica: Csösz, 2012: 28.
Material of the nomen nudum Myrmica rugosa referred here by Mayr, 1855 PDF: 411.
See also: Radchenko, 2007: 29; Radchenko & Elmes, 2010: 259.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Various habitats, also peat-bogs
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

3. M. scabrinodis HNS

mihi. M. caespitum Zett HNS . Ins. Lapp. 450, 1. [[ male ]]. Dahlb. mscrpt. id.

Operaria: testaceo-ferruginea sparse flavo-pilosula, capite supra et abdominis dorso medio fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin flexo, supra geniculo a lobo oblique-transversim posito; metanoti spinis longis.

Femina: testaceo-ferruginea sparse flavido-pilosula, capite supra et abdominis dorso medio fuscescentibus, thorace quoque supra et mesopleuris cum sterno parum fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin geniculatim flexo, geniculo supra angulato; spinis metanoti longiusculis; alis hyalinis obsoletissime cinereo-pallescentibus, stigmate ejusdem coloris distincto.

Mas: nigro-fuscus nitidus sparse tenuiter flavido-pilosulus, mandibularum apicibus et tarsis testaceo-pallescentibus, antennis fusco-rufescentibus; scapo longitudine quintae partis totius antennae; pedibus longe pilosis.

A Cel. Dahlbom exemplaria hujus speciei accepi, inter quae erant [[ queen ]] [[ male ]] deprehensi ad Wadstenam Ostrogothiae d. 17 Aug. 1841 et [[ male ]] alter captus ad Esperoed Scaniae d. 8 ejusdem mensis.

[[ worker ]]. Long. 1 3 / 4 - 2 lin. Simillima iterum praecedenti, sculptura rudiori, area frontali obsoleta et antennarum scapo ut in diagnosi formato. Striae capitis, thoracis petiolique rudes, profundiores quam in praecedentibus, pilositas corporis forte densior et praeterea lamina frontalis aliter constructa, infra nempe margine utrinque aurito-dilatato tenui, processum lamelliformem subsemirotundatum parum elevatum, radices antennarum obtegentem, formante: Area frontalis triangularis parva fere obsoleta. Scapus antennarum basi flexa supra lobo oblique-transverso parvo, subsemirotundato, antice concaviusculo, apice compresso, a parte anteriori viso geniculum parum acutiusculum ostendente. Spinae metanoti longae. Cetera proxime ut in praecedente.

[[ queen ]]. Long. 2 1 / 2 lin. sat similis operariae suae, sed major obscurior. Caput fuscum, inira cum genis, mandibulis et antennis ferrugineo-testaceum. Areas triangularis frontis vix vestigium. Scapus flexura basis supra angulo subrecto, subtus arcuata (lobo dislincto nullo). Spinae metanoti ut in specie precedente, sed nodi petiolares rudius sulcatim rugosi. Alas hyalinas albescentes, anticae 2 1 / 2 lin. longae, a stigmate versus basin obsoletissime cinereo-pallescentes. Cetera ut in diagnosi vel in praecedente.

[[ male ]]. Long. 2 1 / 2 lin. Similis mari M. laevinodis, antennis vero longitudine tantum ilagelli in eadem specie, scapo quintana solum efficiente partem tolius antennae, pedibus longe flavido-pilosis. Mandibulae apice sordide pallidas. Antennas obscure rufescentes, longius tenuiusque pilosas quam feminae et operariae; scapus subcylindricus, longitudine tantum trium articulorum insequentium, crassitudinem articuli ultimi superans; pedicellus suboibiculatus crassior quam ullus septem articulorum sequentium, qui sunt longe verticillatim pilosi; 9,

10 et 11 suborbiculati crassiores; ultimus subcoecus longitudine fere 10 et

11 (simul snmtorum), sed ejusdem ad basin crassitudinis. Est igitur flagellum ut in feminis fere hujus Generis formatura, at articulis 12. Alae minus albescentes quam in [[ queen ]]. Pedes longe undique pilosi, pilis his cinerascentibus in tarsis fere longioribus. Anus obsolete pallescens.

Obs. Cur potissimum mari hujus speciei Cel. Zetterstedt et Dahlbom nomen Linnaei " ccespitum " attribuunt haud perspicio, quando expresse dicit Linnaeus 1. c. " Antennarum infimus articulus tertia tantum pars totius est, " quod minime in nostram speciem quadrat. Linnasi determinationes circa suam F. caespitum HNS ita sunt vagae, ut profecto non facile sit dijudicatu, quamnam ita nominatam voluerit Myrmicam. Latreille et Fabricius (Piez.) sub hoc eodem nomine speciem intellexerunt omnino aliam, quam DD. Zetterstedt et Dahlbom; D. Losana iterum aliam. Nomen ideo hoc tam commixtum, omnino evitavi.

  • Nylander, W. (1846): Adnotationes in monographiam formicarum borealium Europae. Acta Societatis Scientiarum Fennicae 2, 875-944: 930-932, URL:http://antbase.org/ants/publications/4277/4277.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

9. Myrmica scabrinodis Nylander HNS , 1846

Figs. 14, 33,37,49, 55,67.

Myrmica scabrinodis Nylander HNS , 1846:930.

Myrmica pilosiscapus Bondroit HNS , 1920:301.

Myrmica rugulosoides Forel HNS , 1915:29.

Worker: Yellow red to blackish brown according to habitat. The antennal scape is sharply angled and sinuate near the base, often with a slight lateral extension in the larger more deeply sculptured forms. The petiole has a distinctly concave anterior face which meets the truncate dorsal surface at a sharp angle. Head Index: 85.6; Frons Index: 36.8; Frontal Laminae Index: 66.5. Length: 4.0-5.0 mm. Queens. As worker. Length: 5.5-6.5 mm.

Male. Brown to brownish black with profuse long outstanding body and appendage hairs distinctly longer than their appendage width; the antennal scape is short and stout, not longer than the three following funiculus segments. Length: 5.0-6.0 mm.

Distribution. Common throughout Denmark, Fennoscandia and the British IsleRange: Throughout Europe.

Biology. The species has variable habits, being found in a very wide range of habitats. In southern areas it is often associated with the meadow ant Lasius flavus (Fabr.) HNS living in part of the mound nest and preying on the L. flavus HNS workers but may be equally common in woodland, coastal sand, gravel river banks, peat bogs and moorland. Individual nests are small, situated under stones, in tree stumps or in the ground with a few hundred workers and one or a few queens. The alatae fly in August, pairing occurring in the air.

Note. This species is very variable in size and colour. The smaller samples can be confused with M. rugulosa HNS or M. specioides HNS but can be distinguished by the sharply truncate petiole and narrower frons. In Northern Britain colonies of very dark, often deeply sculptured workers are frequently seen with the scape having a slight semi-circular extension at the bend. This is equivalent to the form described as M. pilosiscapus Bondroit HNS ( 1920) and redescribed by Sadil (1951), but there is no clear difference in male or female castes between this and the accepted M. scabrinodis HNS for a specific distinction. Similarly M. rugulosoides Forel HNS (1915) was described as small and weakly sculptured as is frequent in many colonies of this variable species. In some nests large macrergate workers occur with deeper colour and sculpture among the smaller lighter coloured workers while the males of all these variable forms have the constant specific features of long body and appendage hairs and short thick scape.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 55-55, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

3. Myrmica scabrinodis HNS . Pl.VIII. figs.6,7,9,10,11. B.M.

Myrmica scabrinodis HNS , Nyl. Adno. Mon. Form. Bor. Eur. 930.3; Addit. Adno. Mon. Form. Bor. Eur. 1052. 20; Form. Fr. et d'Alger. 81. 6.

Foerst. Hym. Stud. Form. 67. 37.

Schenck, Beschr. Nass. Ameis. p. 78.

Smith, Brit. Form. 115. 1.

Mayr. Form. Austr. 138. 6; Ungar. Ameis. 18. 2.

Myrmica caespitum, Zett. HNS Ins. Lapp. 450. 1.

Myrmica rubra, Curtis HNS , Trans. Linn. Soc. xxi. 213. 1.

Hab. Britain; France; Germany; Hungary; Russia; Finland.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 115-115, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Throughout SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Nylander, W., 1846:
  mihi. M. caespitum Zett . Ins. Lapp. 450, 1. [[ male ]]. Dahlb. mscrpt. id.
 Operaria: testaceo-ferruginea sparse flavo-pilosula, capite supra et abdominis dorso medio fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin flexo, supra geniculo a lobo oblique-transversim posito; metanoti spinis longis.
 Femina: testaceo-ferruginea sparse flavido-pilosula, capite supra et abdominis dorso medio fuscescentibus, thorace quoque supra et mesopleuris cum sterno parum fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin geniculatim flexo, geniculo supra angulato; spinis metanoti longiusculis; alis hyalinis obsoletissime cinereo-pallescentibus, stigmate ejusdem coloris distincto.
 Mas: nigro-fuscus nitidus sparse tenuiter flavido-pilosulus, mandibularum apicibus et tarsis testaceo-pallescentibus, antennis fusco-rufescentibus; scapo longitudine quintae partis totius antennae; pedibus longe pilosis.
 A Cel. Dahlbom exemplaria hujus speciei accepi, inter quae erant [[ queen ]] [[ male ]] deprehensi ad Wadstenam Ostrogothiae d. 17 Aug. 1841 et [[ male ]] alter captus ad Esperoed Scaniae d. 8 ejusdem mensis.
 [[ worker ]]. Long. 1 3 / 4 - 2 lin. Simillima iterum praecedenti, sculptura rudiori, area frontali obsoleta et antennarum scapo ut in diagnosi formato. Striae capitis, thoracis petiolique rudes, profundiores quam in praecedentibus, pilositas corporis forte densior et praeterea lamina frontalis aliter constructa, infra nempe margine utrinque aurito-dilatato tenui, processum lamelliformem subsemirotundatum parum elevatum, radices antennarum obtegentem, formante: Area frontalis triangularis parva fere obsoleta. Scapus antennarum basi flexa supra lobo oblique-transverso parvo, subsemirotundato, antice concaviusculo, apice compresso, a parte anteriori viso geniculum parum acutiusculum ostendente. Spinae metanoti longae. Cetera proxime ut in praecedente.
 [[ queen ]]. Long. 2 1 / 2 lin. sat similis operariae suae, sed major obscurior. Caput fuscum, inira cum genis, mandibulis et antennis ferrugineo-testaceum. Areas triangularis frontis vix vestigium. Scapus flexura basis supra angulo subrecto, subtus arcuata (lobo dislincto nullo). Spinae metanoti ut in specie precedente, sed nodi petiolares rudius sulcatim rugosi. Alas hyalinas albescentes, anticae 2 1 / 2 lin. longae, a stigmate versus basin obsoletissime cinereo-pallescentes. Cetera ut in diagnosi vel in praecedente.
 [[ male ]]. Long. 2 1 / 2 lin. Similis mari M. laevinodis, antennis vero longitudine tantum ilagelli in eadem specie, scapo quintana solum efficiente partem tolius antennae, pedibus longe flavido-pilosis. Mandibulae apice sordide pallidas. Antennas obscure rufescentes, longius tenuiusque pilosas quam feminae et operariae; scapus subcylindricus, longitudine tantum trium articulorum insequentium, crassitudinem articuli ultimi superans; pedicellus suboibiculatus crassior quam ullus septem articulorum sequentium, qui sunt longe verticillatim pilosi; 9,
 10 et 11 suborbiculati crassiores; ultimus subcoecus longitudine fere 10 et
 11 (simul snmtorum), sed ejusdem ad basin crassitudinis. Est igitur flagellum ut in feminis fere hujus Generis formatura, at articulis 12. Alae minus albescentes quam in [[ queen ]]. Pedes longe undique pilosi, pilis his cinerascentibus in tarsis fere longioribus. Anus obsolete pallescens.
  Obs. Cur potissimum mari hujus speciei Cel. Zetterstedt et Dahlbom nomen Linnaei " ccespitum " attribuunt haud perspicio, quando expresse dicit Linnaeus 1. c. " Antennarum infimus articulus tertia tantum pars totius est, " quod minime in nostram speciem quadrat. Linnasi determinationes circa suam F. caespitum ita sunt vagae, ut profecto non facile sit dijudicatu, quamnam ita nominatam voluerit Myrmicam. Latreille et Fabricius (Piez.) sub hoc eodem nomine speciem intellexerunt omnino aliam, quam DD. Zetterstedt et Dahlbom; D. Losana iterum aliam. Nomen ideo hoc tam commixtum, omnino evitavi.
 

Smith, F.:
  Myrmica scabrinodis , Nyl. Adno. Mon. Form. Bor. Eur. 930.3; Addit. Adno. Mon. Form. Bor. Eur. 1052. 20; Form. Fr. et d'Alger. 81. 6.
  Foerst. Hym. Stud. Form. 67. 37.
  Schenck, Beschr. Nass. Ameis. p. 78.
  Smith, Brit. Form. 115. 1.
  Mayr. Form. Austr. 138. 6; Ungar. Ameis. 18. 2.
  Myrmica caespitum, Zett. Ins. Lapp. 450. 1.
  Myrmica rubra, Curtis , Trans. Linn. Soc. xxi. 213. 1.
  Hab. Britain; France; Germany; Hungary; Russia; Finland.
 

Förster, A.:
  Nyl. Adn. p. 930, 3. - Myrm. caespitum Zett. Ins. Lapp. 450, 1. [[male]].
  Operaria: Testaceo-ferruginea, sparse flavido-pilosula, capite supra abdominisque dorso medio fuscescentibus; antennis 12-articulatis, scapo ad basin subgenicalatim flexo; lamina frontali infra margine utrinque aurito-dilatato; capite, thorace noctisque segmenti primi longitudinaliter striatim profunde rugosis; spinis metanoti longis. Long. 1 1/2- 1 1/3 lin.
  Femina: Testaceo-ferruginea, sparse flavido-pilosula, capite cum thorace supra, mesopleuris, mesosterno et abdominis dorso medio fuscescentibus; antennis 12-articulatis, scapo ad basin geniculate flexo; capite, thorace nodisque segmenti primi longitudinaliter striatim profunde rugosis; spinis metanoti longiusculis; alis cinereo-pallescentibus apice hyalinis, area radiali aperta, cubitali prima nervo recurrente. Lg. 2 1/2 lin.
  Mas: Nigro-fuscus, nitidus, sparse tenuiter flavido-pilosulus, mandibularnm apicibus et tarsis testaceo-pallescentibus; antennis 13-articulatis, fusco-rufescentibus, scapo longitudine quinte partis totius antennte; mesonoto postice, scutello basique metanoti longitudinaliter striatim rugulosis; metanoto inermi, tuberculis tantum obsoletis utrinque; alis ut in femina; pedibus pilis sat longis rigidiusculis preditis; nedis segmenti primi ltevibus. Long.. 2-2 1/4 lin.
  Der Arbeiter dieser Art unterscheidet sich leicht von den beiden vorhergehenden Arten dadurch, daß der Schaft an der Basis nicht bloß gebogen, sondern winklig gebrochen ist. Die Mandibeln sind stark längsrunzlig und grob punktirt, der Clypeus mit groben aber nicht eng zusammengedrängten Längsrunzeln , an der Spitze nebst dem Stirnfeld glatt und glänzend . Die Fühler 12-gliedrig, der Schaft an der Basis fast winklig gebrochen, und wenn derselbe zurück- geschlagen, so daß die Spitze sich auf dem Hinterhaupt anlegt, dann sieht man an der Basis drei scharfe Ränder , wovon der äußere nach unten in eine kleine Spitze ausläuft , der mittlere aber als scharfe und sehneidende Kante eine äußere und eine innere. Fläche deutlich trennt, die sich erst in der Mitte des Schaftes.wieder vereinigen. Die Geißel zeigt dieselbe Bildung wie bei den vorhergehenden Arien. Die Stirne ist bis zum Scheitel mit Längsrunzeln bedeckt, aber hinter den Fühlergruben und den Netzaugen zeigt sich die Sculptur mehr netzaderig-runzlig. Die Stirnlappen erweitern sich nach abwärts beträchtlich und zeigen fast bhrförmig erweiterte Ränder ..Der ganze Mittelleib oben, mit Ausnahme der abschüssigen Stelle, dann die Brustseiten sehr grob und etwas unregelmäßig längsrunzhg ; die Domen des Metanotum's lang und spitz, zwischen denselben bemerkt man einige starke Querrunzeln. Die Knoten des ersten Segments stark runzlig, die Furchen an den Seiten noch deutlicher und tiefer als bei ruginodis Nyl . Das 2te Segment auf der Mitte dunkelbraun. Der ganze Körper mit gelblichen Borstenhaaren bedeckt.
  Obgleich die eigentümlich gebildete Stirnlamelle und die Biegung des Schaftes an der Basis diese Nylandersche Art nicht verkennen lassen, so weicht doch unsere Darstellung des Schaftes zu sehr von der Nylander's ab, um nicht.hier darauf aufmerksam mächen zu müssen . Man vergleiche in dieser Beziehnng seine Worte*) mit unserer Ansicht.
  Das Weibchen ist auf Kopf und Hinterleib noch dunkler gefärbt als der Arbeiter, dazu kommt noch, daß das Pronotum am Hinterrande und das Mesohotum an 3 Stellen dunkel gefärbt ist, nämlich am Vorderrände , in der Mitte und an der Seite etwas über der Wurzel der Vorderflügel ; die Färbung des letzteren stellt sich in Form von drei länglichen Flecken dar, welche mitunter mehr oder weniger zusammenfließen . Die Bildung des Kopfes mit Einschluß der Fühler ganz wie bei dem Arbeiter. Der Mittelleib ist jedoch mit Einschluß des Schildchens und der Basis des Metanotum's mit scharfen, groben und graden Längsrunzeln . bedeckt, während die Vorderbrustseiten grob und etwas verworren längsrunzlig sind, die Mittelbrustseiten dagegen verhält- nißmäßig sehr fein, die Hinterbrustseiten aber fast eben so grobrunzlig sich zeigen wie der Mittelbrustrücken . Die abschüssige Stelle ganz glatt, die Dornen des Metanotum's sehr stark aber nicht sehr lang. Die Flügel wasserhell, von der Basis bis zu dem Randmal bräunlich , die Adern an der Basis bräunlich , weiterhin gelblich, das Randmal lichtbraun. Adern und Zellen genau wie bei den beiden vorhergehenden Arten gebildet. Die Knoten des lsten Segments noch schärfer längsrunzlig als bei dem Arbeiter.
  Das Männchen dieser Art unterscheidet sich sehr leicht von denen der beiden vorhergehenden durch die auffallend lange, abstehende, rauhe Behaarung, noch mehr aber durch den sehr kurzen Schaft, denn dieser hat kaum 1/5 von der Länge des ganzen Fühlers , oder höchstens die Lange der drei folgenden Glieder des Fühlers . Der Kopf ist feinrunzlig, die Mandibeln schmal, braun, an der Spitze roth, 4-6 zähnig . Die Fühler braun, die 5gliedrige Keule röth- lich, die übrigen Geißelglieder mit abstehenden, langen Wirtelhaaren. Das Mesonotum 31appig, hinter dem Vereinigungspunkt der beiden Nähte , dann an dem hinteren Theile der Seitenlappen, nebst dem Schildchen und der Basis des Metanotum's fein längsstreifig-runzlig . Die abschüssige Stelle mehr oder weniger, aber sehr fein und nicht sehr deutlich gerunzelt, die Tuberkeln zu beiden Seiten schärfer als bei den beiden vorhergehenden Arten. Die Beine braun, die Gelenke und die Tarsen gelblich, an den letztern ist aber das lste Glied bräunlich . Die Flügel genau wie bei dem Weibchen. Die Knoten des lsten Segments glatt, der vordere indeß in den Seiten und an der hinteren Fläche sehr schwach und nicht besonders deutlich runzlig. Die weiß-gelb- lichen, ganz abstehenden., langen Borstenhaare treten besonders stark an den Beinen hervor.
  Diese Art ist nicht selten, sie scheint vorzugsweise in Nadelholzwaldungen vorzukommen, wo man ihre Kolonien unter Steinen, in Baumstrünken oder unter Moos an der Wurzel der Bäume antrifft.
 

Forel, A., 1890:
  Jardins près de Tébessa .
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Records

 

(Map 11): Bulgaria ( Agosti and Collingwood 1987a , Seifert 1988a , Atanassov and Dlusskij 1992 ); Central Predbalkan: Dermantsi vill. (Lukovit) ( Atanassov 1934 ); Eastern Stara Planina Mts: Sliven ( Forel 1892 ); Sofia Basin: Sofia ( Forel 1892 , Lapeva-Gjonova and Atanasova 2004 , Antonova 2005 , Antonova and Penev 2006 , 2008 ); Vitosha Mt. ( Atanassov 1934 , 1952 ); Plana Mt.: Pasarel vill. ( Vagalinski and Lapeva-Gjonova in press ); Lozenska Planina Mt. ( Vassilev and Evtimov 1973 ), near German monastery ( Antonova and Penev 2008 ); Bakadzhik-Burgas district: Aytos ( Forel 1892 ); Belasitsa Mt.: slopes of Belasitsa Mt. ( Atanassov 1964 , Hubenov et al. 1998 ); Western Rhodopi Mts: Smolyan, Peshtera, Batak ( Lapeva-Gjonova in press (a) ).

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Jardins près de Tébessa .

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

mihi. M. caespitum Zett . Ins. Lapp. 450, 1. [[ male ]]. Dahlb. mscrpt. id.

 

Operaria: testaceo-ferruginea sparse flavo-pilosula, capite supra et abdominis dorso medio fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin flexo, supra geniculo a lobo oblique-transversim posito; metanoti spinis longis.

 

Femina: testaceo-ferruginea sparse flavido-pilosula, capite supra et abdominis dorso medio fuscescentibus, thorace quoque supra et mesopleuris cum sterno parum fuscescentibus; capite, thorace et petiolo longitudinaliter striatim profunde rugosis; antennarum scapo ad basin geniculatim flexo, geniculo supra angulato; spinis metanoti longiusculis; alis hyalinis obsoletissime cinereo-pallescentibus, stigmate ejusdem coloris distincto.

 

Mas: nigro-fuscus nitidus sparse tenuiter flavido-pilosulus, mandibularum apicibus et tarsis testaceo-pallescentibus, antennis fusco-rufescentibus; scapo longitudine quintae partis totius antennae; pedibus longe pilosis.

 

A Cel. Dahlbom exemplaria hujus speciei accepi, inter quae erant [[ queen ]] [[ male ]] deprehensi ad Wadstenam Ostrogothiae d. 17 Aug. 1841 et [[ male ]] alter captus ad Esperoed Scaniae d. 8 ejusdem mensis.

 

[[ worker ]]. Long. 1 3 / 4 - 2 lin. Simillima iterum praecedenti, sculptura rudiori, area frontali obsoleta et antennarum scapo ut in diagnosi formato. Striae capitis, thoracis petiolique rudes, profundiores quam in praecedentibus, pilositas corporis forte densior et praeterea lamina frontalis aliter constructa, infra nempe margine utrinque aurito-dilatato tenui, processum lamelliformem subsemirotundatum parum elevatum, radices antennarum obtegentem, formante: Area frontalis triangularis parva fere obsoleta. Scapus antennarum basi flexa supra lobo oblique-transverso parvo, subsemirotundato, antice concaviusculo, apice compresso, a parte anteriori viso geniculum parum acutiusculum ostendente. Spinae metanoti longae. Cetera proxime ut in praecedente.

 

[[ queen ]]. Long. 2 1 / 2 lin. sat similis operariae suae, sed major obscurior. Caput fuscum, inira cum genis, mandibulis et antennis ferrugineo-testaceum. Areas triangularis frontis vix vestigium. Scapus flexura basis supra angulo subrecto, subtus arcuata (lobo dislincto nullo). Spinae metanoti ut in specie precedente, sed nodi petiolares rudius sulcatim rugosi. Alas hyalinas albescentes, anticae 2 1 / 2 lin. longae, a stigmate versus basin obsoletissime cinereo-pallescentes. Cetera ut in diagnosi vel in praecedente.

 

[[ male ]]. Long. 2 1 / 2 lin. Similis mari M. laevinodis, antennis vero longitudine tantum ilagelli in eadem specie, scapo quintana solum efficiente partem tolius antennae, pedibus longe flavido-pilosis. Mandibulae apice sordide pallidas. Antennas obscure rufescentes, longius tenuiusque pilosas quam feminae et operariae; scapus subcylindricus, longitudine tantum trium articulorum insequentium, crassitudinem articuli ultimi superans; pedicellus suboibiculatus crassior quam ullus septem articulorum sequentium, qui sunt longe verticillatim pilosi; 9,

 

10 et 11 suborbiculati crassiores; ultimus subcoecus longitudine fere 10 et

 

11 (simul snmtorum), sed ejusdem ad basin crassitudinis. Est igitur flagellum ut in feminis fere hujus Generis formatura, at articulis 12. Alae minus albescentes quam in [[ queen ]]. Pedes longe undique pilosi, pilis his cinerascentibus in tarsis fere longioribus. Anus obsolete pallescens.

 

Obs. Cur potissimum mari hujus speciei Cel. Zetterstedt et Dahlbom nomen Linnaei " ccespitum " attribuunt haud perspicio, quando expresse dicit Linnaeus 1. c. " Antennarum infimus articulus tertia tantum pars totius est, " quod minime in nostram speciem quadrat. Linnasi determinationes circa suam F. caespitum ita sunt vagae, ut profecto non facile sit dijudicatu, quamnam ita nominatam voluerit Myrmicam. Latreille et Fabricius (Piez.) sub hoc eodem nomine speciem intellexerunt omnino aliam, quam DD. Zetterstedt et Dahlbom; D. Losana iterum aliam. Nomen ideo hoc tam commixtum, omnino evitavi.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmica scabrinodis , Nyl. Adno. Mon. Form. Bor. Eur. 930.3; Addit. Adno. Mon. Form. Bor. Eur. 1052. 20; Form. Fr. et d'Alger. 81. 6.

 

Foerst. Hym. Stud. Form. 67. 37.

 

Schenck, Beschr. Nass. Ameis. p. 78.

 

Smith, Brit. Form. 115. 1.

 

Mayr. Form. Austr. 138. 6; Ungar. Ameis. 18. 2.

 

Myrmica caespitum, Zett. Ins. Lapp. 450. 1.

 

Myrmica rubra, Curtis , Trans. Linn. Soc. xxi. 213. 1.

 

Hab. Britain; France; Germany; Hungary; Russia; Finland.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nyl. Adn. p. 930, 3. - Myrm. caespitum Zett. Ins. Lapp. 450, 1. [[male]].

 

Operaria: Testaceo-ferruginea, sparse flavido-pilosula, capite supra abdominisque dorso medio fuscescentibus; antennis 12-articulatis, scapo ad basin subgenicalatim flexo; lamina frontali infra margine utrinque aurito-dilatato; capite, thorace noctisque segmenti primi longitudinaliter striatim profunde rugosis; spinis metanoti longis. Long. 1 1/2- 1 1/3 lin.

 

Femina: Testaceo-ferruginea, sparse flavido-pilosula, capite cum thorace supra, mesopleuris, mesosterno et abdominis dorso medio fuscescentibus; antennis 12-articulatis, scapo ad basin geniculate flexo; capite, thorace nodisque segmenti primi longitudinaliter striatim profunde rugosis; spinis metanoti longiusculis; alis cinereo-pallescentibus apice hyalinis, area radiali aperta, cubitali prima nervo recurrente. Lg. 2 1/2 lin.

 

Mas: Nigro-fuscus, nitidus, sparse tenuiter flavido-pilosulus, mandibularnm apicibus et tarsis testaceo-pallescentibus; antennis 13-articulatis, fusco-rufescentibus, scapo longitudine quinte partis totius antennte; mesonoto postice, scutello basique metanoti longitudinaliter striatim rugulosis; metanoto inermi, tuberculis tantum obsoletis utrinque; alis ut in femina; pedibus pilis sat longis rigidiusculis preditis; nedis segmenti primi ltevibus. Long.. 2-2 1/4 lin.

 

Der Arbeiter dieser Art unterscheidet sich leicht von den beiden vorhergehenden Arten dadurch, daß der Schaft an der Basis nicht bloß gebogen, sondern winklig gebrochen ist. Die Mandibeln sind stark längsrunzlig und grob punktirt, der Clypeus mit groben aber nicht eng zusammengedrängtenLängsrunzeln , an der Spitze nebst dem Stirnfeld glatt und glänzend . Die Fühler 12-gliedrig, der Schaft an der Basis fast winklig gebrochen, und wenn derselbe zurück- geschlagen, so daß die Spitze sich auf dem Hinterhaupt anlegt, dann sieht man an der Basis drei scharfe Ränder , wovon der äußere nach unten in eine kleine Spitze ausläuft , der mittlere aber als scharfe und sehneidende Kante eine äußere und eine innere. Fläche deutlich trennt, die sich erst in der Mitte des Schaftes.wieder vereinigen. Die Geißel zeigt dieselbe Bildung wie bei den vorhergehenden Arien. Die Stirne ist bis zum Scheitel mit Längsrunzeln bedeckt, aber hinter den Fühlergruben und den Netzaugen zeigt sich die Sculptur mehr netzaderig-runzlig. Die Stirnlappen erweitern sich nach abwärtsbeträchtlich und zeigen fast bhrförmig erweiterte Ränder ..Der ganze Mittelleib oben, mit Ausnahme der abschüssigen Stelle, dann die Brustseiten sehr grob und etwas unregelmäßiglängsrunzhg ; die Domen des Metanotum's lang und spitz, zwischen denselben bemerkt man einige starke Querrunzeln. Die Knoten des ersten Segments stark runzlig, die Furchen an den Seiten noch deutlicher und tiefer als bei ruginodis Nyl . Das 2te Segment auf der Mitte dunkelbraun. Der ganze Körper mit gelblichen Borstenhaaren bedeckt.

 

Obgleich die eigentümlich gebildete Stirnlamelle und die Biegung des Schaftes an der Basis diese Nylandersche Art nicht verkennen lassen, so weicht doch unsere Darstellung des Schaftes zu sehr von der Nylander's ab, um nicht.hier darauf aufmerksam mächen zu müssen . Man vergleiche in dieser Beziehnng seine Worte*) mit unserer Ansicht.

 

Das Weibchen ist auf Kopf und Hinterleib noch dunkler gefärbt als der Arbeiter, dazu kommt noch, daß das Pronotum am Hinterrande und das Mesohotum an 3 Stellen dunkel gefärbt ist, nämlich am Vorderrände , in der Mitte und an der Seite etwas über der Wurzel der Vorderflügel ; die Färbung des letzteren stellt sich in Form von drei länglichen Flecken dar, welche mitunter mehr oder weniger zusammenfließen . Die Bildung des Kopfes mit Einschluß der Fühler ganz wie bei dem Arbeiter. Der Mittelleib ist jedoch mit Einschluß des Schildchens und der Basis des Metanotum's mit scharfen, groben und graden Längsrunzeln . bedeckt, während die Vorderbrustseiten grob und etwas verworren längsrunzlig sind, die Mittelbrustseiten dagegen verhält-nißmäßig sehr fein, die Hinterbrustseiten aber fast eben so grobrunzlig sich zeigen wie der Mittelbrustrücken . Die abschüssige Stelle ganz glatt, die Dornen des Metanotum's sehr stark aber nicht sehr lang. Die Flügel wasserhell, von der Basis bis zu dem Randmal bräunlich , die Adern an der Basis bräunlich , weiterhin gelblich, das Randmal lichtbraun. Adern und Zellen genau wie bei den beiden vorhergehenden Arten gebildet. Die Knoten des lsten Segments noch schärferlängsrunzlig als bei dem Arbeiter.

 

Das Männchen dieser Art unterscheidet sich sehr leicht von denen der beiden vorhergehenden durch die auffallend lange, abstehende, rauhe Behaarung, noch mehr aber durch den sehr kurzen Schaft, denn dieser hat kaum 1/5 von der Länge des ganzen Fühlers , oder höchstens die Lange der drei folgenden Glieder des Fühlers . Der Kopf ist feinrunzlig, die Mandibeln schmal, braun, an der Spitze roth, 4-6 zähnig . Die Fühler braun, die 5gliedrige Keule röth- lich, die übrigenGeißelglieder mit abstehenden, langen Wirtelhaaren. Das Mesonotum 31appig, hinter dem Vereinigungspunkt der beiden Nähte , dann an dem hinteren Theile der Seitenlappen, nebst dem Schildchen und der Basis des Metanotum's fein längsstreifig-runzlig . Die abschüssige Stelle mehr oder weniger, aber sehr fein und nicht sehr deutlich gerunzelt, die Tuberkeln zu beiden Seiten schärfer als bei den beiden vorhergehenden Arten. Die Beine braun, die Gelenke und die Tarsen gelblich, an den letztern ist aber das lste Glied bräunlich . Die Flügel genau wie bei dem Weibchen. Die Knoten des lsten Segments glatt, der vordere indeß in den Seiten und an der hinteren Fläche sehr schwach und nicht besonders deutlich runzlig. Die weiß-gelb- lichen, ganz abstehenden., langen Borstenhaare treten besonders stark an den Beinen hervor.

 

Diese Art ist nicht selten, sie scheint vorzugsweise in Nadelholzwaldungen vorzukommen, wo man ihre Kolonien unter Steinen, in Baumstrünken oder unter Moos an der Wurzel der Bäume antrifft.

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Animal / predator
adult of Hallodapus montandoni is predator of Myrmica scabrinodis
Remarks: season: late 7-early 9

In Great Britain and/or Ireland:
Animal / guest
adult of Myrmica karavajevi is a guest in nest of Myrmica scabrinodis

Plant / resting place / within
nest of Myrmica scabrinodis may be found in decayed stump of Trees

Plant / resting place / within
nest of Myrmica scabrinodis may be found in bogs of Sphagnum

Animal / guest
nymph of Notochilus limbatus is a guest in nest of Myrmica scabrinodis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myrmica scabrinodis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTTCAATAAGAATAATTATTCGTTTAGAATTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACTTTAGTAACTAGCCATGCATTTATTATAATTTTTTTTATAGTTATACCTTTCATAATCGGAGGCTTTGGAAATTTTTTAGTTCCCTTAATG---CTCGGGTCACCTGACATAGCCTATCCTCGTATAAATAATATAAGATTTTGACTACTTCCTCCATCAATTATATTATTAATATTAAGAAATTTTTTAAGGAATGGTGTAGGAACAGGATGAACAATTTATCCCCCATTAGCTTCTAATATTTTTCATAGAGGCCCTTCAGTTGATATATCA---ATCTTTTCCTTGCATATGGCGGGGATATCTTCAATTCTTGGAGCAATCAATTTTATCTCAACAATTATTAATATACACCACAAATCAATTTCAATGGATAAAACTCCACTAATAGTATGATCAATTATAATTACAGCTATTCTTCTTCTTTTATCCCTTCCTGTTTTAGCGGGA---GCCATTACTATATTACTTACAGATCGAAATTTAAATACTTCATTTTTTGATCCTTCAGGAGGAGGTGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCATCCTGAAGTCTATATTTTAATTTTACCTGGATTCGGATTAATTTCTCATATTATTATAAGTGAAAGAGGTAAAAAA---GAAACATTTGGGTCTCTTGGTATAATTTATGCTATAATTGCAATTGGATTTTTAGGATTTATTGTCTGAGCACATCATATATTTACTATTGGTTTAGATGTAGATACTCGGGCTTATTTTACTTCCGCAACTATAATTATTGCCATTCCCACAGGTATTAAAATTTTTAGTTGAATTTCT---ACCCTTCATGGCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica scabrinodis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myrmica scabrinodis

Myrmica scabrinodis is a Euro-Siberian species of ants. It lives in moderately humid habitats, tolerates soil moisture but also needs direct sunshine. It often inhabits peat bogs. It builds nests in the ground, in grass or moss tussocks, even under stones or in rotten wood. Its colonies are monogynous or have only a few queens and may contain about 2500 workers. This ant species is the main host of the entomopathogenic fungus Rickia wasmannii. Phengaris caterpillars are primary threats of M. scabrinodis with specific species such as Phengaris arion developing a predatory relationship.[1]

Subspecies[2][edit]

References[edit]

  1. ^ Sielezniew, Marcin; Dario Patricelli, Izabela Dziekańska, Francesca Barbero, Simona Bonelli, Luca Pietro Casacci , Magdalena Witek & Emilio Balletto (2010). "The First Record of Myrmica lonae (Hymenoptera: Formicidae) as a Host of the Socially Parasitic Large Blue Butterfly Phengaris (Maculinea)* arion(Lepidoptera: Lycaenidae)". Sociobiology 56: 465–475. 
  2. ^ "Myrmica scabrinodis Nylander 1846". Fauna Europaea. Retrieved 18 June 2012. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!