Overview

Comprehensive Description

Busycon caricais a member of the family Melongenidae and one of roughly fourteen known species of the subfamily Bucyconinae. Members of the genus Busycon are the largest marine gastropods along the eastern coast of the United States (Ram 1977). Juvenile whelks have small beads on their shells, while adult whelk shells are thick with spines on the shoulder. Knobbed whelk shells are right-handed and have a long siphonal canal. The outer shell is grayish white to tan and may have some dark brown streaks. The brown streaks are more prominent in juvenile shells. The inner shell ranges in colors from pale yellow to orange and even dark red.
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range: 41.6°N to 29°N; 81.3°W to 70.6°W. Distribution: USA: Massachusetts, Rhode Island, New York, New Jersey, Delaware, Virginia, North Carolina, Georgia, Florida; Florida: East Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Busycon caricaoccur on the coast of the Atlantic from Cape Cod, Massachusetts to Cape Canaveral, Florida. Knobbed whelks are mainly found in estuaries, bays and shallow shelf waters (Magalhaes 1948). They occur at depths of 1 to 50 meters. The knobbed whelk occurs in the Indian River Lagoon, but is not common.
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Knobbed whelks reach maturity in about three to five years. Whelks are considered to be protandric hermaphrodites initially functioning as males and changing into females as they age (Castagna and Kraeuter 1994, Anderson 2005). Adult females are generally larger than adult males of the same age. Adult whelks may be as long as 30.5 cm (Magalhaes 1948).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 24.69
  Temperature range (°C): 17.205 - 23.731
  Nitrate (umol/L): 0.327 - 1.034
  Salinity (PPS): 33.112 - 35.209
  Oxygen (ml/l): 4.870 - 5.619
  Phosphate (umol/l): 0.133 - 0.314
  Silicate (umol/l): 1.081 - 1.861

Graphical representation

Depth range (m): 0 - 24.69

Temperature range (°C): 17.205 - 23.731

Nitrate (umol/L): 0.327 - 1.034

Salinity (PPS): 33.112 - 35.209

Oxygen (ml/l): 4.870 - 5.619

Phosphate (umol/l): 0.133 - 0.314

Silicate (umol/l): 1.081 - 1.861
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Busycon caricais a carnivorous gastropod that feeds on bivalves. They use the lip of their shell to break off and force open the valves of their prey by holding it with its foot. Slow chipping continues until there is an opening that allows the whelk to lodge its shell between the bivalves's valves and then enter its foot to begin feeding. The feeding process generally results in damage to the whelks shell which causes limited growth in adults since a lot of energy is used to repair their shell. Some bay men from estuaries along the New Jersey and New York coasts suggest that B. carica cause severe predation of oysters (Carriker 1951).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

The deal shells of Busycons are host to several species of Crepidula and oyster spats and often inhabited by hermit crabs (Magalhaes 1948).Fishery: Knobbed whelks are mainly used for their meat. The whelk trawl fishery off the South Carolina coast became an important fishery during 1977 and the spring of 1978 during periodic closure of the shrimp season (Anderson et al. 1985). In Delaware, the whelk dredge landings were 18.5 million tons of meat from 1994-2000 and increased to 241.6 million tons from 2001-2004 (Bruce 2006). Members in this genus are also sold in the tourist trade as ornamentals (Magalhaes 1948).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Busycon caricais a common species of the shallow shelf ecosystem and estuaries especially in South Carolina and Georgia. The density of the knobbed whelk in Beaufort, North Carolina was estimated to be 1 individual per 79 2 during non-reproductive seasons (Magalhaes 1948). Migration: Busycon spp. migrate from deep to shallow waters in times of reproduction and low food supply (Magalhaes 1948). Locomotion: Knobbed whelks glide along or just beneath the sand on the ocean floor (Magalhaes 1948).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Male and female Busycon caricamate by coupling. The reproductive season for the knobbed whelk in Beaufort, North Carolina is reported to begin in March and lasts through September (Magalhaes 1948). In South Carolina, B. carica reproduces during the fall and spring (Anderson 2005). After fertilization occurs the female lays a string of eggs in deep water and anchors the string to the sand by one end. The capsules of B. carica are wide with two smooth surfaces resembling book covers (Magalhaes 1948, Ram 1977). These strings of eggs consist of up to 40 pouches, with each pouch containing up to 100 fertilized eggs. Field studies have shown that egg strings are laid in the fall on tidal and intertidal flats and over winter to hatch in the spring (Castagna and Kraeuter 1994).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

The fertilized eggs of the knobbed whelk develop slowly and hatch in approximately 3 to 13 months (Anderson 2005). The larva emerge as juveniles and measure approximately 4 mm in length. Under laboratory conditions, the shells of the hatchling were observed to grow 1.5 mm in 22 days (Magalhaes 1948).
  • Anderson WD. 2005 Busycon carica. Comprehensive Wildlife Conservation Strategy; SC Department of Natural Resources. Available online as a pdf file.
  • Anderson WD, Eversole AG, Anderson BA and KB Van Sant. 1985. A biological evaluation of the knobbed whelk fishery in South Carolina. National Marine Fisheries Service Publication. 2-392-R 76 pp.
  • Bruce DG. 2006. The whelk dredge fishery of Delaware. Journal of Shellfish Research 25:1-13.
  • Carriker MR. 1951. Observations on the penetration of tightly closing bivalves by Busycon and other predators. Ecology. 32(1):73-83.
  • Castagna M and JN Kraeuter. 1994. Age, growth rate, sexual dimorphism and fecundity of knobbed whelk Busycon carica(Gmelin,1791) in a western Mid-Atlantic lagoon system, Virginia. Journal of Shellfish Research. 2(2): 581-585.
  • The Georgia Shell Club Whelk Page. Available online.
  • Hardy's Internet Guide to Marine Gastropods. Available online.
  • Magalhaes H. 1948. An ecological study of the genus Busycon at Beaufort, North Carolina. Ecological Monographs. 18(3): 377-409.
  • Ram JL. 1977. Hormonal control of reproduction in Busycon: Laying of egg capsules caused by nervous system extracts. Marine Biological Laboratory. Biol. Bull., 152: 221-232.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Busycon carica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATATATCTTATTTGGTATATGATCAGGATTGGTTGGTACTGCCTTAAGCCTTCTTATTCGAGCTGAATTAGGACAGCCAGGAGCTTTGCTTGGTGAT---GATCAACTTTATAACGTAATTGTAACAGCACATGCTTTTGTAATAATCTTTTTTTTAGTTATGCCTATAATGATTGGAGGATTTGGGAACTGGTTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTTTAAATAATATAAGATTTTGGTTATTGCCCCCTGCCTTATTATTGTTACTTTCATCAGCTGCAGTAGAAAGTGGTGTAGGTACTGGATGAACTGTATATCCCCCTTTAGCAGGAAATTTAGCTCATGCCGGAGGTTCTGTAGACTTAGCAATTTTTTCTTTACATCTTGCAGGAGCTTCATCGATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAATATACGATGACGAGGTATGCAGTTCGAACGACTTCCTTTATTTGTATGATCAGTAAAAATTACAGCTATTTTATTGCTTTTATCTCTGCCAGTCTTAGCCGGAGCCATTACAATACTTTTAACTGATCGAAATTTTAACACAGCCTTTTTCGATCCAGCAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Busycon carica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Knobbed whelk

The knobbed whelk, Busycon carica, is a species of very large predatory sea snail, or in the USA, a whelk, a marine gastropod mollusk in the family Buccinidae, the busycon whelks.

The knobbed whelk is the second largest species of busycon whelk, ranging in size up to 12 in (305 mm).

Distribution[edit]

Knobbed whelks are native to the North Atlantic coast of North America from Cape Cod, Massachusetts to northern Florida. This species is common along the Georgia coast. It is the state shell of New Jersey and Georgia.

Shell description[edit]

Knobbed whelk shells

The shell of most knobbed whelks is dextral, meaning that it is right-handed. If the shell is held in front of the viewer, with the spiral end up and the opening facing the viewer, the opening will be on the right side. The shell is thick and strong and has six clockwise coils. The surface is sculpted with fine striations and there is a ring of knob-like projections protruding from the widest part of the coil. The color is ivory or pale gray and the large aperture (the inside of the opening) is orange. The canal inside is wide and the entrance can be closed by a horny oval operculum.[2][3]

Life habits[edit]

The knobbed whelk lives subtidally and is migratory, alternating between deep and shallow water, depending on the time of year.

During the weather extremes of the summer and winter months, these sea snails live in deep water, at depths of up to 48 m. In the milder weather of the spring and fall they live in shallow water, on near-shore or intertidal mud flats and sand flats.

On the shallow-water mud flats whelks prey on oysters, clams, and other marine bivalves. They wedge a bivalve open using the edge of their shell, and insert their long proboscis to eat the flesh of their victim. They rasp at the flesh using their radula, a rough tongue-like organ that has thousands of tiny denticles (tooth-like protrusions).

Reproduction[edit]

Whelk egg case

Mating and egg laying occur during the spring and fall migration. Internally fertilized eggs are surrounded by a transparent mass of albumen, a gel-like material, and are laid in protective flat, rounded egg capsules joined to form a paper-like chain of egg cases, commonly called a "Mermaid's Necklace". On average each capsule contains 0-99 eggs, with most strings having 40-160 capsules. After laying their egg cases, female knobbed whelk will bury one end of the egg case into the substrate, thus providing an anchor for the developing fertilized eggs and preventing the string of egg cases from washing ashore where it would dehydrate. Fertilized eggs emerge as juvenile knobbed whelks approximately 4 mm in length.

Human use[edit]

As with conchs, the knobbed whelk is used by humans as food in such dishes as salads (raw), burgers, fritters, and chowders.

As is also true of conch shells, the shell of the knobbed whelk can be made into a natural bugle by cutting off the tip of the spire in order to form a mouthpiece.

References[edit]

  1. ^ Busycon carica (Gmelin, 1791) World Register of Marine Species. Retrieved 2011-11-28.
  2. ^ Knobbed Whelk: Shell Money Retrieved 2011-11-28.
  3. ^ Anatomy of the knobbed whelk
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!