Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Brief Summary

American slipper limpets look like slippers, therefore their name. They live off of plankton which they filter out of the seawater. They are often found piled one on top of another (up to twelve specimen), a real slipper limpet skyscraper. The snails at the top of the tower are always younger and male, the middle ones are in the process of changing sex and the lowest ones are older and female. American slipper limpets were imported during the previous century from North America, along with a load of oysters.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The shell is oval, up to 5 cm in length, with a much reduced spire. The large aperture has a shelf, or septum, extending half its length. The shell is smooth with irregular growth lines and white, cream, yellow or pinkish in colour with streaks or blotches of red or brown. Slipper limpets are commonly found in curved chains of up to 12 animals. Large shells are found at the bottom of the chain, with the shells becoming progressively smaller towards the top.Crepidula fornicata is a non-native species. The modern British population is known to have been introduced to Essex between 1887 and 1890 in association with oysters, Crassostrea virginica, imported from North America (Fretter & Graham, 1981; Eno et al., 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic, Atlantic Europe, Baltic sea, Belgian Exclusive Economic Zone, Blankenberge, Bristol Channel, Canada, De Haan, De Panne, Dorset, Dutch Exclusive Economic Zone, East Coast of England, East Coast of Ireland, Elbe, European waters (ERMS scope), German Bight, Greek Exclusive Economic Zone, Grevelingen, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Gulf of St-Malo, Irish Exclusive economic Zone, Irish Sea, Katwijk, Koksijde, Lorneville Harbour, Malta, Mediterranean Sea, Minas Basin, Nieuwpoort, North Sea, North West Atlantic, Oostduinkerke, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Sam Orr Pond, South Coast of Ireland, Spanish Exclusive Economic Zone, Spuikom, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, Wadden Sea, Wimereux, Zeebrugge
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the older fauna lists (e.g. De Malzine (1867), Colbeau (1868), Pelseneer (1881b), Maitland (1897) and Vonck (1933)) Crepidula fornicata is absent, contrary to nowadays. This species was introduced only in the thirties 

 For a discussion on the way of distribution and introduction see: Adam, W.; Leloup, E. (1934). Sur la présence du gastéropode Crepidula fornicata (Linné, 1758) sur la côte belge. [Occurrence of the gastropod Crepidula fornicata (Linné, 1758) at the Belgian coast.] Bull. Mus. royal d'Hist. Nat. Belg./Med. Kon. Natuurhist. Mus. Belg. 10(45): 1-6.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range: 48°N to 25°N; 97.2°W to 25°W. Distribution: Canada; Canada: Nova Scotia, Prince Edward Island, New Brunswick; USA: Maine, Massachusetts, Connecticut, New York, New Jersey, Virginia, North Carolina, Georgia, Florida; Florida: East Florida, West Florida; USA: Louisiana, Texas; introduced to the state of Washington.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1859 specimens in 1 taxon.
Water temperature and chemistry ranges based on 71 samples.

Environmental ranges
  Depth range (m): -1.5 - 142
  Temperature range (°C): 6.920 - 26.823
  Nitrate (umol/L): 0.325 - 12.432
  Salinity (PPS): 32.282 - 36.284
  Oxygen (ml/l): 4.350 - 6.764
  Phosphate (umol/l): 0.076 - 1.123
  Silicate (umol/l): 0.756 - 10.019

Graphical representation

Depth range (m): -1.5 - 142

Temperature range (°C): 6.920 - 26.823

Nitrate (umol/L): 0.325 - 12.432

Salinity (PPS): 32.282 - 36.284

Oxygen (ml/l): 4.350 - 6.764

Phosphate (umol/l): 0.076 - 1.123

Silicate (umol/l): 0.756 - 10.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Crepidula fornicata is typically found attached to shells and stones on soft substrata around the low water mark and the shallow sublittoral. It is often attached to the shells of mussels Mytilus edulis and oysters Ostrea edulis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Introduction

Species introduced
  • Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alien species

The common Atlantic slipper snail or slipper limpet Crepidula fornicata originates from the east coast of North-America. The species was however brought to Europe together with the eastern oyster Crassostrea virginica. In Belgium, the first slipper limpet was found on 28 September 1911 attached to an oyster in Ostend and since the 1930’s, it is seen as a common species along the Belgian coast. The slipper limpet has little to no predators here, and can thrive on several types of hard bottoms and shellfish banks. A continued expansion to the north is probably inhibited by temperature: low temperatures during the winter can slow down or inhibit the development of the slipper limpet.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Crepidula fornicata (Suspension-feeding molluscs) preys on:
phytoplankton
bacterioplankton
Microprotozoa

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crepidula fornicata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTTGGTATATGATCTGGACTAGTAGGAACAGCTCTAAGATTATTAATCCGAGCTGAACTTGGACAACCAGGTGCTCTCCTAGGCGAT---GATCAACTATACAATGTAATTGTTACAGCACACGCTTTTGTTATAATCTTTTTTCTAGTAATACCTATAATAATCGGGGGATTTGGTAATTGGTTAGTTCCATTAATGTTAGGTGCTCCTGATATAGCTTTTCCTCGACTTAATAACATAAGTTTCTGATTATTACCTCCAGCATTATTACTATTGCTATCCTCGGCCGCAGTAGAAAGAGGAGTTGGGACCGGTTGAACGGTTTATCCTCCTTTGTCTGGAAACCTAGCTCACGCTGGCGGGTCTGTTGATTTAGCAATTTTTTCTTTACATCTTGCTGGTGTTTCATCAATTTTAGGAGCTGTTAATTTTATTACTACTGTAATTAATATACGTTGACAAGGAGTTCAATTTGAACGACTTCCTTTATTTGTATGATCAGTTAAAATTACAGCCATTCTATTATTACTTTCTTTACCAGTGTTAGCCGGAGCAATTACGATGCTTTTATCAGATCGAAATTTTAATACCGCTTTCTTTGATCCTGCAGGAGGAGGTGATCCTATCTTATATCAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crepidula fornicata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common slipper shell

The common slipper shell, Crepidula fornicata, has many other common names including common Atlantic slippersnail, boat shell, quarterdeck shell, fornicating slipper snail, and it is known in Britain as the "common slipper limpet". This is a species of medium-sized sea snail, a marine gastropod mollusc in the family Calyptraeidae, the slipper snails and cup and saucer snails.

Contents

Description

10 fresh shells of Crepidula fornicata

The size of the shell is 20–50 mm.[1] The maximum recorded shell length is 56 mm.[2]

This sea snail has an arched, rounded shell. On the inside of the shell there is a white "deck" which causes the shell to resemble a boat or a slipper, hence the common names. Some of these may be flat, slightly arched, or arched heavily. The 'Flat slipper shell' is also another type of slipper shell.

Distribution

The species is native to the western Atlantic Ocean, specifically the Eastern coast of North America. It has been introduced accidentally to other parts of the world and has become problematic.

Distribution of Crepidula fornicata ranges from 48°N to 25°N; 97.2°W to 25°W[1] from as far north as Nova Scotia to as far south as the Gulf of Mexico.[1]

Nonindigenous distribution

Two beachworn shells of Crepidula fornicata from North Wales

It was introduced to the state of Washington.[1] The species was however brought to Europe together with the eastern oyster Crassostrea virginica.[1] In Belgium, the first slipper limpet was found on 28 September 1911 attached to an oyster in Ostend and since the 1930s, it is seen as a common species along Belgian coast.[1]

The species is considered an invasive species in Denmark, France, Italy, the Netherlands, Spain, and the UK, and has also spread to Norway and Sweden.[3] It is known to damage oyster fisheries.[4] The slipper limpet has little to no predators in Europe, and can thrive on several types of hard bottoms and shellfish banks.[1] A continued expansion to the north is probably inhibited by temperature: low temperatures during the winter can slow down or inhibit the development of the slipper limpet.[1]

It has also been introduced to the Pacific Northwest and Japan.[5]

Ecology

Habitat

This is a common snail, usually found intertidally, infralittoral and circalittoral and in estuaries.[1]

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 70 m.[2]

They are often found, sometimes living stacked on top of one another, rocks,[1] on horseshoe crabs, shells and on dock pilings.

Feeding habits

Generally for Calyptraeidae, feeding habits include planktonic and minute detrital food items through either suspension or deposit feeding.[1]

Life cycle

The species is a sequential hermaphrodite. The largest and oldest animals, at the base of a pile are female, the younger and smaller animals at the top are male. If the females in the stack die, the largest of the males will become a female.[6]

References

This article incorpoates CC-BY-SA-3.0 text from the reference [1]

  1. ^ a b c d e f g h i j k l Gofas, S. (2010). Crepidula fornicata (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138963 on 2011-01-13
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  3. ^ Global Invasive Species Database
  4. ^ Joint Nature Conservation Committee
  5. ^ Marine Life Information Network for Britain and Ireland
  6. ^ Global Invasive Species Database
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!