Overview

Comprehensive Description

The Flamingo Tongue Snail (Cyphoma gibbosum) is a common and easily recognized gastropod mollusk found in shallow waters of the tropical western Atlantic. It has a bright orange, white, and black pattern on the mantle folds that cover the shell in life. It feeds as an ectoparasite on a broad range of octocorals, with at least 21 alcyonacean octocoral host species known (Rosenberg 1989; Reijnen et al. 2010). However, some octocorals appear to be avoided entirely and Flamingo Tongue Snails are unevenly distributed among the corals on which they are found. Lasker et al. (1988) suggested that in addition to actual feeding preferences, a number of other factors (such as intraspecific social interactions and predator avoidance) likely influence the host associations of these snails. Nowlis (1993) found, for example, that both mate searching and oviposition behavior can influence host associations.

At least parts of a Flamingo Tongue Snail are distasteful to at least some predators and it seems likely that the striking coloration of these snails is aposematic (i.e., functions as a warning signal to potential predators) (Rosenberg 1989; Guilford and Cuthill 1991; Rosenberg 1991). However, some predators apparently do consume these snails. Burkepile and Hay (2007) found that when large predatory fishes and invertebrates were excluded from portions of a coral reef in the Florida Keys (U.S.A.), Flamingo Tongue Snail population densities increased 19-fold and grazing damage to gorgonian corals was far more frequent and extensive. Thus, predators of these snails appear to be indirectly protecting the corals, with the implication that overfishing of these predators could be very detrimental to gorgonian corals as well.

The Flamingo Tongue Snail lays its eggs singly in clear, domed capsules and the young emerge as free-swimming larvae (Rehder 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Belize, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Jamaica, Lesser Antilles, Mexico, Panama, Puerto Rico, San Andres, Venezuela
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 1 - 274
  Temperature range (°C): 15.246 - 27.692
  Nitrate (umol/L): 0.213 - 15.147
  Salinity (PPS): 35.370 - 36.231
  Oxygen (ml/l): 3.335 - 4.714
  Phosphate (umol/l): 0.006 - 0.917
  Silicate (umol/l): 0.993 - 7.222

Graphical representation

Depth range (m): 1 - 274

Temperature range (°C): 15.246 - 27.692

Nitrate (umol/L): 0.213 - 15.147

Salinity (PPS): 35.370 - 36.231

Oxygen (ml/l): 3.335 - 4.714

Phosphate (umol/l): 0.006 - 0.917

Silicate (umol/l): 0.993 - 7.222
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyphoma gibbosum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GGTATGTGGTCAGGATTGGTTGGTACAGCTCTTAGTTTATTAATTCGAGCTGAGTTAGGTCAACCAGGTGCTCTTTTGGGAGAT---GACCAACTATATAATGTAATTGTAACTGCTCACGCTTTTGTTATAATTTTCTTCTTGGTTATGCCTATAATGATTGGAGGTTTTGGTAATTGACTGGTTCCTTTAATATTAGGGGCTCCCGATATAGCTTTTCCTCGTCTTAATAACATAAGATTTTGACTTTTACCACCAGCTTTACTTCTTTTACTTTCATCAGCTGCTGTAGAAAGTGGGGTTGGTACAGGGTGAACAGTTTATCCTCCTTTGGCTGGAAACTTGGCTCATGCTGGTGGTTCAGTAGATTTAGCTATTTTTTCTTTACATCTTGCAGGTGTATCTTCTATTTTAGGTGCAGTAAACTTTATTACAACTATTATTAATATGCGTTGGCGAGGTATGCAGTTTGAGCGGCTACCTTTGTTCGTTTGGTCTGTAAAGATTACTGCAGTATTACTCTTGTTATCTCTTCCTGTTTTGGCTGGAGCTATTACTATGCTTTTAACTGATCGAAATTTTAATACGGCTTTCTTTGACCCTGCAGGAGGTGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cyphoma gibbosum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Flamingo tongue snail

The flamingo tongue snail, scientific name Cyphoma gibbosum, is a species of small but brightly colored sea snail, a marine gastropod mollusk in the family Ovulidae, the cowry allies. Although the live animal is brightly colored, that color is only in the soft parts; the shell itself is plain white.

Contents

Distribution

This Cyphoma is distributed in the Mid-Atlantic Ridge. It is the most common of several species in the genus which live in the tropical waters of the Western Atlantic Ocean, including the Caribbean Sea, the Gulf of Mexico and the Lesser Antilles. It can also be found from North Carolina, the Bermudas to Northern Brazil.

Shell description

The shells of this quite common species reach on average 25–35 millimetres (0.98–1.4 in) of length, with a minimum size of 18 millimetres (0.71 in) and a maximum shell length of 44 millimetres (1.7 in). .[2] The shape is usually elongated and the dorsum shows a thick trasversal ridge. The dorsum surface is smooth and sparkly and may be white or orange, with no markings at all except a longitudinal white or cream band. The base and the interior of Cyphoma gibbosum shell is white or pinkish, with a wide aperture. These shells vaguely resemble the shells of cowries.

Description of the live animal

When it is alive, the snail appears bright orange-yellow in color with black markings. However, these colors are not in the shell, but are only due to live mantle tissue which usually cover the shell. The mantle flaps can be retracted, exposing the shell, but this usually happens only when the animal is attacked.

Ecology

Flamingo tongue on a sea fan

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 29 m.[2]

The flamingo feeds by browsing on the living tissues of the soft corals on which it lives. Common prey include Briareum spp., Gorgonia spp., Plexaura spp., and Plexaurella spp. Adult female C. gibbosum attach eggs to coral which they have recently fed upon. After roughly a week and a half, the larvae hatch. They are planktonic and eventually settle onto other gorgonian corals. Juveniles tend to remain on the underside of coral branches while adults are far more visible and mobile. Adults scrape the polyps off the coral with their radula, leaving an easily visible feeding scar on the coral. However, the corals can regrow the polyps, and therefore predation by C. gibbosum is generally not lethal.

Survival status

This species used to be common, but it has become rather uncommon because of over-collecting by snorkelers and scuba divers, who make the mistake of thinking that the color is the shell of the animal.

References

  1. ^ WoRMS (2009). Cyphoma gibbosa (Linnaeus, 1758). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=419727 on 2010-05-24
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!