Overview

Distribution

Range Description

This species has a wide geographic distribution ranging from southern Japan along the coast of China to Malaysia and Indonesia in the South and the Philippines (Reid et al. 2005). Its range encompasses the Sea of Japan, Yellow Sea, East and South China Sea, Gulf of Thailand, Andaman Sea, Java Sea and Sulu Sea (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a large, demersal species that buries into sand (Reid et al. 2005). In the Gulf of Thailand the sex ratio is biased towards females (M:F) 1:2 (Reid et al. 2005). It is abundant between 20 and 40 m in the Gulf of Thailand and Andaman Sea, and 60 and 100 m in the South China Sea (Reid et al. 2005). It overwinters in deeper water between 60 and 100 m before moving to shallower depths to spawn in spring and early summer (Reid et al. 2005). The egg capsules are attached to twigs and other hard structures (Reid et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepia lycidas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTTATTTTTGGAATTTGATCAGGTTTATTAGGAACATCTTTAAGATTAATAATCCGAAGAGAACTAGGCAAACCAGGTACTTTACTAAATGAT---GATCAATTATATAATGTAATAGTAACAGCCCATGGATTTATTATAATTTTCTTTTTAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCACCAGATATAGCATTCCCACGTATAAATAATATAAGATTCTGATTACTTCCTCCTTCATTAACATTACTACTCTCATCATCAGCAGTAGAAAGTGGAGCAGGTACAGGATGAACTGTTTACCCACCATTATCTAGAAACTTATCACATGCAGGACCTTCAGTAGATTTAGCTATCTTCTCTTTACATTTAGCAGGTGTATCTTCAATTTTAGGAGCTATTAATTTCATTACAACAATTTTAAATATACGATGAGAAGGTTTACAAATAGAACGTTTACCATTATTTGCATGATCAGTATTCATTACAGCTATTTTATTATTATTATCATTACCTGTGTTAGCAGGTGCCATTACAATACTTTTAACTGACCGAAATTTTAATACCACTTTTTTTGACCCAAGTGGTGGTGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sepia lycidas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Sepia lycidas has been assessed as Data Deficient as data on the impact of fishing are not available. This species is commercially important in several Asian countries, particularly towards the northern boundary of the Indo-West Pacific. Although the species has an extensive geographic range extending southwards from the Yellow Sea to Indonesian Seas, it is fished very hard across much of its range and more data are required to assess the impacts of this.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Ocean acidification caused by increased levels of carbon dioxide in the atmosphere is potentially a threat to all cuttlefish. Studies have shown that under high pCO2 concentrations, cuttlefishes actually lay down a denser cuttlebone which is likely to negatively affect buoyancy regulation (Gutowska et al. 2010). It is a commercially important fishery species in many countries of southeast Asia (Reid et al. 2005). It is caught using a variety of gear types including through the use of live cuttlefish as bait during the spawning season and bait at other times of the year (Reid et al. 2005). It is also caught as bycatch (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is required into trends in population size and the impacts of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!