Overview

Distribution

Central Indo-Pacific to Japan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

According to Reid and Jereb (2005), the Mimka Bobtail Squid (Euprymna morsei) ranges from southern Japan southwards along the coast of Korea and China to Malaysia and Indonesia (Java), taking in the East and South China Seas, the Yellow Sea, Gulf of Thailand and the Philippines (Reid and Jereb 2005). However, Norman and Lu (1997) believe this to be a temperate species restricted to cooler waters around Japan. Further taxonomic work on the genus is required to be enable accurate delineation of the species and their geographic boundaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthopelagic, coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is a shallow water species with a mantle length of up to 40 mm (Reid and Jereb 2005). It is preyed on by lancet fishes, Alepisaurus ferox (Reid and Jereb 2005). This species has a light organ in its gill cavity which emits just enough light to hide its silhouette at night from predators (Norman 2003). Mature males have enlarged suckers on their second, third and fourth arm pairs (Norman 2003). It is very similar in appearance and distribution range to Euprymna berryi, in fact females are indistinguishable from one another (Norman 2003). Members of the subfamily Sepiolinae are bottom living species that typically bury in soft sediments during the day, and emerge at night to feed (Norman 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 18 - 222
  Temperature range (°C): 17.712 - 17.712
  Nitrate (umol/L): 7.823 - 7.823
  Salinity (PPS): 35.413 - 35.413
  Oxygen (ml/l): 3.865 - 3.865
  Phosphate (umol/l): 0.756 - 0.756
  Silicate (umol/l): 4.548 - 4.548

Graphical representation

Depth range (m): 18 - 222
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Euprymna morsei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Euprymna morsei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACTTTATTTTTGGTATTTGATCTGGCTTATTAGGAACATCTTTAAGTTTAATAATTCGAACTGAATTAGGTAAACCTGGTTCTTTACTAAATGAT---GATCAATTATATAATGTAGTAGTAACTGCCCATGGTTTTGTAATAATTTTCTTTTTAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCATTAACATTACTATTAGCTTCCTCAGCTGTAGAAAGTGGAGCAGGAACAGGTTGAACAGTATATCCCCCCTTATCTAGAAATATCTCACATGCAGGCCCTTCAGTTGATTTAGCTATTTTTTCTCTCCATTTGGCTGGGGTTTCCTCTATCCTAGGAGCTATTAACTTTATTACAACTATTATAAATATACGGTGAGAAGGTTTACAAATAGAACGATTACCTTTATTCGTTTGATCAGTTTTTATTACTGCAATCTTACTATTATTATCCTTACCAGTTTTAGCCGGAGCTATTACAATACTGTTAACAGATCGAAACTTTAATACCACTTTTTTTGACCCCAGAGGAGGAGGGGACCCTATTTTATATCAACACCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Euprymna morsei has been assessed as Data Deficient due to the persistence of taxonomic problems in the delineation of species in this genus makes it impossible to determine whether it is threatened on a global scale. It is sometimes caught locally for food and as bycatch and without good distribution data it is impossible to assess the impact of this.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is caught on a very small scale and sometimes as bycatch (Reid and Jereb 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further research is required to resolve taxonomic uncertainties and determine population trends and life history patterns of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!