Overview

Brief Summary

Introduction

Maximum mantle length 28 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Loligo gahi d'Orbigny, 1835

 

 

Loligo gahi d'Orbigny, 1835, p. 316; Thore, 1959, p.15; Castellanos and Menni, 1968, p. 11; Castellanos and Cazzaniga, 1979, p. 61.

 

Loligo patagonica Smith, 1881, p. 21; Filippova, 1969, p. 52; Castellanos and Cazzaniga, 1977, p. 123.

 

 

Material Examined. —Holotype: M ML 114.0 mm, from Valparaiso, Chile, Muséum National d'His­toire Naturelle, Paris. Other Material: 3 M ML 74.0-84.4 mm, 4 F ML 77.0-96.4 mm, SHINKAI MARU, 45°30'S, 64°30'W, 25 Feb. 1979, UMML 31.1786. 9 M ML 68.0-182.0 mm, F ML 101.4 mm, SHINKAI MARU, 47°43'S, 65°34'W, 28 Feb. 1979, UMML 31.1787. 2 M ML 78.2-93.4 mm, 5 F ML 82.4-100.0 mm, R/V HERO Cr. 692 Sta. 5006, 53°21'S, 70°52.5'W, 16 May 1969, UMML 31.1788. 5 M ML 70.8-130.8 mm, 2 F ML 75.6-82.0 mm, from Talcahuano Bay, Chile, April 1957, UMML 31.1223. 2 F ML 61.4-63.8 mm, H.M.S. ALERT, Trinidad Channel West Coast of Patagonia, British Museum of Natural History, 1880, 10.8.2-3. 3 M ML 215.0-277.0 mm, 17°38'S, 72°18'W, 16 March 1941, USNM 574180.

 

 

Description. —Mantle moderately long (ML 68.0-277.0 mm), cylindrical and bluntly pointed posteriorly; width about one fourth of length (MWI—males 15.3-­21.1-26.5, females 17.1-22.8-28.5); anterior margin is wide, slightly flared, and has distinct dorsal lappet marking anterior end of gladius; ventral margin exca­vated below funnel with pointed angles marking location of mantle funnel locking apparatus.

 

Fins rhombic in outline with rounded lateral angles; anterior margins slightly convex; posterior margins slightly concave; fins widest at midpoint and occupy less than 50% of mantle length regardless of body size (FLI—males 37.8-44.5-­49.7, females 38.8-44.8-49.8; FWI—males 36.7-41.7-48.1, females 40.3-44.8­-48.1).

 

Head about half as long as wide (HWI—males 16.5-21.1-26.5, females 18.1-­21.5-25.2).

 

Funnel stout and compact, reaching to about middle of eye. Mantle-funnel locking apparatus simple and straight. Dorsal member of the funnel organ Λ shaped with large oval ventral pads.

 

Buccal membrane seven lobed, with supports attached dorsally on arms I and II and ventrally on arms III and IV; each lobe with 5 to 9 ringed suckers; females have spermatophore pad on ventral portion of buccal membrane.

 

 

Table 1. Measurements (in mm) and indices of 20 male specimens of Loligo gahi (♂*=holotype)

                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

ML

 
 

69.0

 
 

70.8

 
 

72.2

 
 

74.0

 
 

74.0

 
 

76.4

 
 

78.2

 
 

79.0

 
 

84.0

 
 

84.4

 
 

MWI

 
 

26.5

 
 

20.1

 
 

26.0

 
 

25.7

 
 

25.9

 
 

25.4

 
 

20.7

 
 

25.3

 
 

19.5

 
 

26.5

 
 

HWI

 
 

21.5

 
 

21.2

 
 

24.9

 
 

20.3

 
 

21.6

 
 

23.6

 
 

20.5

 
 

23.0

 
 

23.1

 
 

21.3

 
 

FLI

 
 

40.0

 
 

41.5

 
 

42.7

 
 

40.0

 
 

37.8

 
 

42.7

 
 

42.2

 
 

45.6

 
 

46.2

 
 

42.2

 
 

FWI

 
 

42.4

 
 

37.6

 
 

37.4

 
 

44.3

 
 

38.1

 
 

45.5

 
 

43.0

 
 

40.0

 
 

40.7

 
 

43.9

 
 

I

 
 

34.4

 
 

33.6

 
 

30.5

 
 

30.0

 
 

34.3

 
 

30.6

 
 

26.1

 
 

27.3

 
 

33.3

 
 

30.3

 
 

II

 
 

44.1

 
 

36.6

 
 

36.6

 
 

36.5

 
 

47.0

 
 

36.6

 
 

36.6

 
 

35.9

 
 

40.2

 
 

41.5

 
 

III

 
 

44.1

 
 

41.0

 
 

39.1

 
 

36.5

 
 

45.1

 
 

37.7

 
 

36.6

 
 

42.3

 
 

43.8

 
 

40.3

 
 

IVr

 
 

38.8

 
 

39.5

 
 

39.3

 
 

33.2

 
 

40.5

 
 

36.6

 
 

32.2

 
 

36.5

 
 

40.7

 
 

37.2

 
 

IVl

 
 

38.2

 
 

40.1

 
 

38.2

 
 

33.0

 
 

37.8

 
 

35.6

 
 

32.0

 
 

35.4

 
 

41.0

 
 

37.2

 
 

HcLI

 
 

34.6

 
 

37.3

 
 

39.1

 
 

30.3

 
 

36.4

 
 

28.7

 
 

35.2

 
 

39.3

 
 

35.5

 
 

28.7

 
 

TLI

 
 

102.4

 
 

80.8

 
 

63.7

 
 

88.4

 
 

97.8

 
 

94.8

 
 

53.5

 
 

82.8

 
 

72.9

 
 

84.4

 
 

CLI

 
 

28.5

 
 

26.3

 
 

21.3

 
 

26.5

 
 

29.7

 
 

27.5

 
 

21.7

 
 

24.6

 
 

24.3

 
 

31.0

 
 

ASI

 
 

1.6

 
 

1.4

 
 

1.5

 
 

1.4

 
 

1.9

 
 

1.4

 
 

1.4

 
 

1.5

 
 

1.4

 
 

1.6

 
 

TSI S

 
 

0.9

 
 

0.8

 
 

0.7

 
 

0.7

 
 

0.8

 
 

0.7

 
 

0.8

 
 

0.6

 
 

0.8

 
 

0.7

 
 

TSI L

 
 

1.5

 
 

1.6

 
 

1.5

 
 

1.4

 
 

1.6

 
 

1.6

 
 

1.5

 
 

1.4

 
 

1.5

 
 

1.3

 
 

GWI

 
 

13.7

 
 

13.8

 
 

15.4

 
 

14.3

 
 

14.5

 
 

13.9

 
 

-

 
 

-

 
 

15.3

 
 

14.2

 
 

VLI

 
 

74.3

 
 

67.4

 
 

68.9

 
 

71.6

 
 

65.2

 
 

73.7

 
 

-

 
 

-

 
 

71.5

 
 

79.7

 
 

RWI

 
 

4.3

 
 

4.8

 
 

4.6

 
 

4.1

 
 

4.5

 
 

4.3

 
 

-

 
 

-

 
 

4.4

 
 

4.5

 
 

 
 

 
 

 
 

 
 

 
 

♂*

 
 

 
 

 
 

 
 

 
 

 
 

ML

 
 

86.0

 
 

88.4

 
 

93.4

 
 

99.8

 
 

114.0

 
 

118.4

 
 

122.4

 
 

123.0

 
 

130.8

 
 

182.0

 
 

MWI

 
 

24.9

 
 

23.8

 
 

17.3

 
 

22.0

 
 

22.8

 
 

15.4

 
 

20.4

 
 

21.0

 
 

15.3

 
 

17.3

 
 

HWI

 
 

23.7

 
 

21.0

 
 

19.7

 
 

20.0

 
 

17.5

 
 

18.4

 
 

18.0

 
 

19.2

 
 

17.9

 
 

16.5

 
 

FLI

 
 

47.0

 
 

46.4

 
 

42.4

 
 

46.1

 
 

46.5

 
 

49.3

 
 

45.8

 
 

46.0

 
 

49.7

 
 

49.7

 
 

FWI

 
 

40.7

 
 

41.9

 
 

42.2

 
 

42.5

 
 

41.2

 
 

46.1

 
 

40.4

 
 

43.6

 
 

44.8

 
 

36.7

 
 

I

 
 

28.1

 
 

31.0

 
 

27.2

 
 

33.1

 
 

24.0

 
 

26.7

 
 

25.3

 
 

27.6

 
 

24.8

 
 

22.0

 
 

II

 
 

37.0

 
 

37.3

 
 

36.2

 
 

40.7

 
 

31.6

 
 

32.9

 
 

30.4

 
 

33.2

 
 

27.7

 
 

27.3

 
 

III

 
 

40.5

 
 

40.7

 
 

35.3

 
 

44.3

 
 

34.2

 
 

36.1

 
 

37.6

 
 

37.4

 
 

32.6

 
 

31.9

 
 

IVr

 
 

36.7

 
 

38.7

 
 

34.3

 
 

38.1

 
 

31.6

 
 

33.8

 
 

33.0

 
 

33.2

 
 

29.8

 
 

29.0

 
 

IVl

 
 

34.0

 
 

35.5

 
 

33.6

 
 

39.1

 
 

30.7

 
 

31.3

 
 

31.9

 
 

32.5

 
 

27.8

 
 

28.4

 
 

HcLI

 
 

22.6

 
 

22.9

 
 

36.3

 
 

36.4

 
 

34.3

 
 

35.1

 
 

38.5

 
 

39.0

 
 

39.0

 
 

34.9

 
 

TLI

 
 

82.6

 
 

77.6

 
 

66.6

 
 

-

 
 

77.2

 
 

35.8

 
 

75.5

 
 

70.7

 
 

42.5

 
 

78.6

 
 

CLI

 
 

30.0

 
 

34.2

 
 

21.4

 
 

-

 
 

21.1

 
 

23.3

 
 

21.9

 
 

22.3

 
 

17.7

 
 

23.1

 
 

ASI

 
 

1.7

 
 

1.5

 
 

1.4

 
 

1.4

 
 

1.2

 
 

1.4

 
 

1.5

 
 

1.4

 
 

1.2

 
 

1.3

 
 

TSI S

 
 

0.9

 
 

0.7

 
 

0.7

 
 

-

 
 

0.6

 
 

0.7

 
 

0.8

 
 

0.8

 
 

0.8

 
 

-

 
 

TSI L

 
 

2.0

 
 

1.6

 
 

1.4

 
 

-

 
 

1.4

 
 

1.5

 
 

1.5

 
 

1.5

 
 

1.4

 
 

-

 
 

GWI

 
 

12.9

 
 

13.5

 
 

14.0

 
 

-

 
 

-

 
 

-

 
 

13.0

 
 

12.8

 
 

-

 
 

10.6

 
 

VLI

 
 

77.1

 
 

65.5

 
 

74.6

 
 

-

 
 

-

 
 

-

 
 

72.6

 
 

70.7

 
 

-

 
 

74.5

 
 

RWI

 
 

4.0

 
 

4.5

 
 

3.8

 
 

-

 
 

-

 
 

-

 
 

4.6

 
 

4.5

 
 

-

 
 

3.3

 
 

 

Arms of moderate length and in order III.IV.II.I, although some variation occurs
(Tables 1, 2). Dorsal and ventral protective membranes border sucker rows on all arms. Arm suckers in two rows and of medium size; dentition consists of 6 or 7 broad flat teeth on distal half of ring; proximal half smooth (Fig. 1F) Two central teeth often narrower than those on either side. No obvious sexual di­morphism found in either size or dentition of suckers of specimens of similar size. Measurements for arm sucker index (ASI) taken from row seven of right arm III. Left ventral arm hectocotylized (Fig. 2E) in male for less than half its length (HcLI— 22.6-34.7-39.3); proximally about 18 to 22 pairs of normal suck­ers; on distal ⅓ of the arm, at about row 20, suckers of dorsal row greatly reduced in size and supported by elongated triangular pedicels that become smaller distally. Suckers of ventral row unmodified. Low folded ridge connects bases of dorsal and ventral sucker rows in modified portion of arm; 18-22 pairs of suckers in modified area.

 

 

Table 2. Measurements (in mm) and indices of 12 female specimens of Loligo gahi

                                                                                                                                                                                                                                                                                                                
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

 
 

ML

 
 

75.6

 
 

77.0

 
 

79.6

 
 

82.0

 
 

82.4

 
 

83.4

 
 

86.0

 
 

92.8

 
 

96.4

 
 

96.6

 
 

100.0

 
 

101.4

 
 

MWI

 
 

19.0

 
 

27.8

 
 

27.6

 
 

19.5

 
 

20.6

 
 

28.5

 
 

22.3

 
 

17.1

 
 

25.9

 
 

19.7

 
 

19.6

 
 

25.6

 
 

HWI

 
 

22.8

 
 

25.2

 
 

21.4

 
 

22.4

 
 

21.4

 
 

22.1

 
 

23.3

 
 

18.3

 
 

21.8

 
 

20.5

 
 

20.4

 
 

18.1

 
 

FLI

 
 

45.2

 
 

42.3

 
 

40.7

 
 

49.8

 
 

45.6

 
 

38.8

 
 

49.1

 
 

43.3

 
 

44.6

 
 

44.9

 
 

44.2

 
 

49.1

 
 

FWI

 
 

42.9

 
 

40.3

 
 

45.0

 
 

46.6

 
 

45.4

 
 

41.2

 
 

48.1

 
 

44.0

 
 

46.9

 
 

44.5

 
 

45.0

 
 

47.5

 
 

I

 
 

28.0

 
 

30.4

 
 

25.1

 
 

27.3

 
 

25.0

 
 

28.3

 
 

26.5

 
 

25.2

 
 

25.6

 
 

24.8

 
 

25.4

 
 

28.4

 
 

II

 
 

33.6

 
 

36.9

 
 

33.4

 
 

33.2

 
 

33.3

 
 

36.0

 
 

34.2

 
 

32.3

 
 

35.3

 
 

33.3

 
 

34.0

 
 

30.0

 
 

III

 
 

37.8

 
 

40.3

 
 

33.7

 
 

36.6

 
 

35.2

 
 

36.0

 
 

34.9

 
 

32.5

 
 

34.9

 
 

33.5

 
 

34.2

 
 

36.7

 
 

IVr

 
 

32.3

 
 

35.8

 
 

31.4

 
 

35.6

 
 

30.3

 
 

33.8

 
 

32.1

 
 

30.4

 
 

33.6

 
 

32.7

 
 

31.4

 
 

30.6

 
 

IVl

 
 

33.3

 
 

34.5

 
 

32.7

 
 

33.2

 
 

30.8

 
 

33.3

 
 

33.0

 
 

30.0

 
 

32.8

 
 

32.9

 
 

30.4

 
 

30.6

 
 

HcLI

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

-

 
 

TLI

 
 

79.4

 
 

84.4

 
 

-

 
 

96.3

 
 

52.4

 
 

80.7

 
 

85.6

 
 

52.8

 
 

87.8

 
 

74.5

 
 

57.0

 
 

-

 
 

CLI

 
 

25.4

 
 

27.2

 
 

-

 
 

25.4

 
 

20.6

 
 

26.9

 
 

19.3

 
 

19.4

 
 

28.6

 
 

24.0

 
 

22.0

 
 

-

 
 

ASI

 
 

1.2

 
 

1.3

 
 

1.4

 
 

1.1

 
 

1.3

 
 

-

 
 

1.4

 
 

1.2

 
 

1.1

 
 

1.3

 
 

1.1

 
 

1.3

 
 

TSI S

 
 

0.8

 
 

0.8

 
 

-

 
 

0.7

 
 

0.7

 
 

0.8

 
 

0.9

 
 

0.8

 
 

0.8

 
 

0.8

 
 

0.7

 
 

-

 
 

TSI L

 
 

1.6

 
 

1.6

 
 

-

 
 

1.6

 
 

1.5

 
 

1.7

 
 

1.6

 
 

1.5

 
 

1.8

 
 

1.6

 
 

1.5

 
 

-

 
 

GWI

 
 

18.4

 
 

-

 
 

-

 
 

-

 
 

14.3

 
 

13.3

 
 

13.9

 
 

13.3

 
 

14.8

 
 

15.7

 
 

-

 
 

18.6

 
 

VLI

 
 

69.1

 
 

-

 
 

-

 
 

-

 
 

71.8

 
 

71.1

 
 

74.2

 
 

72.8

 
 

71.6

 
 

76.7

 
 

-

 
 

73.2

 
 

RWI

 
 

4.7

 
 

-

 
 

-

 
 

-

 
 

4.3

 
 

4.3

 
 

3.9

 
 

4.3

 
 

4.1

 
 

4.1

 
 

-

 
 

4.3

 
 

 

Tentacular stalks long and compressed, with dorsal keels that expand into swimming membranes at base of clubs (Fig. 1 C). Orally, median groove extends to club where margins diverge to form two protective membranes. Distinct manus and dactylus present but no distinguishable carpus. About 37-42 transverse rows of suckers arranged in four longitudinal rows. On manus suckers enlarged, with those of marginal row ½ or less size of median ones. Chitinous sucker rings with regularly spaced pointed teeth longest on lateral side of median suckers (Fig. 1 D) and on outer side of marginal ones (Fig. 1 E). Some variation occurs in relative sizes of teeth on sucker rings.

 

 

Table 3. Ranges and means of indices of measurements of 20 males and 12 females of Loligo gahi

                                                                                                        
 

Index

 
 

Range and Mean: Males

 
 

Range and Mean: Females

 
 

Mantle length

 
 

68.0-96.0-182.0

 
 

75.6-87.8-101.4

 
 

MWI

 
 

15.3-21.1-26.5

 
 

17.1-22.8-28.5

 
 

HWI

 
 

16.5-20.6-24.9

 
 

18.1-21.5-25.2

 
 

FLI

 
 

37.8-44.5-49.7

 
 

38.8-44.8-49.8

 
 

FWI

 
 

36.7-41.7-46.1

 
 

40.3-44.8-48.1

 
 

I

 
 

22.0-29.0-34.3

 
 

25.0-26.7-30.4

 
 

II

 
 

27.3-36.3-47.0

 
 

30.0-33.8-36.9

 
 

III

 
 

31.9-38.6-45.1

 
 

32.5-35.5-40.3

 
 

IVr

 
 

29.0-35.6-40.7

 
 

30.3-32.5-35.8

 
 

IVl

 
 

27.8-34.7-41.0

 
 

30.4-32.3-34.5

 
 

HcLI

 
 

22.6-34.7-39.3

 
 

-

 
 

TLI

 
 

35.8-75.2-102.4

 
 

57.0-75.1-96.3

 
 

CLI

 
 

17.7-25.1-31.0

 
 

19.2-23.9-28.6

 
 

ASI

 
 

1.2-1.5-1.9

 
 

1.1-1.3-1.5

 
 

TSI S

 
 

0.6-0.8-0.9

 
 

0.7-0.8-0.9

 
 

TSI L

 
 

1.3-1.5-2.0

 
 

1.5-1.6-1.8

 
 

GWI

 
 

12.8-13.7-15.4

 
 

13.3-15.3-18.6

 
 

VLI

 
 

65.2-72.0-79.9

 
 

69.1-72.6-76.7

 
 

RWI

 
 

3.3-4.4-5.0

 
 

3.9-4.3-4.7

 
 

 

 

Spermatophores (Fig. 2A) removed from five males of sizes 72.2, 79.0, 84.4, 123.0, and 182.0 mm mantle length. Spermatophores large and thick, length varied from 6.5 to 11.4 mm (SpLI-5.8-9.5); cement body thick with constriction about half way down its length.

 

Gladius long and slender (Fig. 1 A; GWI — males 12.8-13.7-15.4, females 13.3­15.3-18.6); edges of vanes only slightly curved without lateral thickenings or at most broad diffuse ones. Radula shown in Figure 2D; beaks shown in Figure 2B, C.

 

 

Distribution. —Known from the coastal waters of South America from southern Peru to northern Argentina but northern limits on both coasts have yet to be established. The depth range for the specimens at hand is 0-185 m.

 

 

Type. — M ML 114.0 mm, Museum National d'Histoire Naturelle, Paris.

 

 

Type Locality. —Valparaiso, Chile.

 

 

Remarks. —Loligo gahi was first described and figured from Valparaiso, Chile by d'Orbigny (1835). Since that date it has been treated by Castellanos and Menni (1968) and Castellanos and Cazzaniga (1979) but no modern descriptions or illustrations have been published. This is a common inshore squid and is fished over parts of its range.”

 

(Brakoniecki, 1984: 436-441)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Biology

Occurs from the surface to 350 m depth but usually only to 285 m. The greatest numbers of juveniles were consistently caught in waters of <100 m to the south and east of East Falkland. Most D. gahi juveniles aggregate close to the sea floor.

Inshore spawning sites of D. gahi were found in the waters of East Falkland (Southwest Atlantic), where there is a major fishery based on this species. Egg masses occurred in algal beds, often at the outer (seaward) edge, with ambient water temperatures of 6.5-9 C. Egg strands were attached to the kelp algae Lessonia spp. and Macrocystis pyrifera from 0.5 m to 2.5 m off the bottom at 8-20 m depths. The capsules are mainly 50-60 mm in length and contain an average of 70 fertilized eggs. Eggs laid in winter are significantly larger than those laid in summer.

Doryteuthis gahi increase in size and maturity with depth. Immature and fully mature squid were found at depths less than or equal to 100 m. The data support the hypothesis that this species spawns in shallow water and migrates down the continental shelf and continental slope after hatching. It then returns to shallow water to spawn. Highest concentrations of squid appeared to occur at depths and in areas where the commercial fishery operates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle moderately elongate.
  2. Fins
    1. Fins rhomboidal, short, their length about 40 to 45% of mantle length.
  3. Arms
    1. Arms elongate, especially ventral and ventrolateral.
    2. Arm sucker rings with 6 or 7 broad, flat teeth in distal half, proximal half smooth.
    3. Left ventral arm hectocotylized in dista1 1/3: suckers on dorsal row greatly reduced in size and set on elongated, triangular, swollen pedicles that grade smaller distally; ventral row unmodified.
  4. Tentacles
    1. Tentacles long, slender.
    2. Clubs narrow, unexpanded, with relatively small suckers on manus.
    3. Median suckers about 2 times the diameter of the marginal suckers
    4. Teeth on club sucker rings pointed, very numerous: 25 to 35 (possibly 45).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Distribution

Eastern Pacific Ocean from southern Peru to southern Chile; reported in the South Atlantic from the Gulf of San Matias, Argentina to Tierra del Fuego. The northern limits on both coasts are unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loligo gahi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGGCTAGTAGGCACTTCATTAAGATTAATAATTCGTACAGAACTGGGAAAACCTGGTTCCTTACTGAATGAT---GATCAATTATATAATGTAGTGGTTACAGCACACGGTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGATTCGGAAATTGACTTGTACCCTTAATATTAGGTGCTCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCGCCCTCACTCACCCTTCTCCTTGCGTCTTCTGCTGTTGAAAGTGGAGCGGGAACTGGTTGAACAGTTTACCCTCCTTTATCTAGTAACCTTTCTCATGCTGGCCCTTCTGTAGATCTTGCTATTTTTTCTCTACATTTAGCTGGGATTTCCTCTATTTTAGGAGCAATTAACTTTATTACAACCATTATAAACATACGATGAGAAGGTTTATTAATAGAACGACTTTCTCTATTTGTTTGATCTGTTTTTATTACTGCTATTCTTCTCCTTCTTTCTCTCCCAGTACTAGCTGGTGCCATTACAATATTACTAACCGATCGAAACTTTAACACTACTTTCTTTGACCCAAGGGGGGGAGGRGACCCTATTCTTTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Loligo gahi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!