Overview

Brief Summary

Introduction

Species of Stigmatoteuthis are distinctive in having very long arms relative to the ML and paired secondary reproductive organs (penis, spermatophore gland complex, Needham's sac). For the general morphology of a representative of this species-group, see the Stigmatoteuthis hoylei page. S. dofleini appears to be restricted to the temperate waters of the North Pacific. However, species in the hoylei species group are separated primarily on features of mature males and such males are uncommon in collections. Therefore, the distribution is tentative.

Diagnosis

A histioteuthid

  • found in temperate North Pacific waters.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Nomenclature

All world-wide specimens in Stigmatoteuthis were considered by Voss (1969) to belong to H. dofleini. Voss et al. (1992) after examining the type of Histiopsis hoylei Goodrich, 1896, placed all known specimens in the synonomy of this earlier named species, Histioteuthis hoylei (Goodrich, 1896). Voss et al., (1998) recognized that the Atlantic form was diffferent and should be called H. arcturi (Robson, 1948). They based the separation primarily on striking differences in the spermatophore and hectocotylus of the mature male. Unfortunately few mature specimens were known for comparisons. The males that represented H. hoylei came from north temperate waters off California and Japan. We have examined specimens from off Hawaii and found they have spermatophores with the distinctive ejaculatory apparatus of H. arcturi from the Atlantic but differ in some features of the hectocotylus. Therefore, the Pacific forms divide into a temperate North Pacific species which carries the name, H. dofleini, and a more southern species, H. hoylei. Instead of placing H. hoylei and H. arcturi in synonomy, we maintain the separation of these species as Voss et al.,(1998) list other separating characters such as features of the gladius, beak, web and arm lengths that are not all related to maturity and are based on squids from a wider geographical range. We place all members of the hoylei-group into the genus Stigmatoteuthis.

In this clade of histioteuthids with bilaterally paired male secondary sexual organs, the first species described was Histiopsis hoylei Goodrich 1896. However, the type species of the nominal genus Histiopsis is H. atlantica, which has unpaired male organs and Histiopsis was subsequently placed in the synonomy of Histioteuthis (Voss,1969). Pfeffer (1900) described the genus Stigmatoteuthis, with type species S. hoylei (Goodrich 1896) by monotypy. (This is not the same species as Meleagroteuthis hoylei Pfeffer, 1900 which, according to Nesis, 1987, is a synonym of Histioteuthis meleagroteuthis.) Therefore Stigmatoteuthis Pfeffer 1900 is the valid-genus name designated for a species in this clade.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Reproductive system
    1. Spermatophore ejaculatory apparatus with single loop.
    2. Sperm mass 46-60% of SpL.
    3. Hectocotylus with 2 sucker series throughout.
    4. Hectocotylus without papillated skin on ventral surface.

Comments

Species of Stigmatoteuthis are easily recognized by the Type 1a photophore pattern of the head which has 3 photophores in the Midline Series and no rogue photophore (see pattern of S. hoylei). S. dofleini is most easily separated from other members of the hoylei-group by the structure of the spermatophore, especially the simple arrangement of the ejaculatory apparatus with a single loop and by its temperate North Pacific distribution.

More details of the description can be found here.

Species Stigmatoteuthis are characterized by the presence of:

  1. Tentacular clubs
    1. Medial suckers of tentacular clubs greatly enlarged, more than 4X diameter of minute marginal suckers.
  2. Photophores
    1. Type 1a pattern on head (e.g., 3 Midline Series photophores, 3 Basal Arm IV Row photophores and no rogue photophore).
    2. Basal Row on head with 8 photophores and 3 sawteeth.
    3. Right Basal Series on head present.
    4. Ends of arms IV without separate group of compound photophores.
    5. Compound photophores of large, uniform size and evenly spaced on anterior half of ventral mantle.
  3. Tubercles
    1. Absent.
  4. Mantle
    1. Skin of the mantle and elsewhere with dermal warts beneath outer epithelium in large squid.
  5. Viscera
    1. Mail genitalia paired.

With the exception of the analysis of the head photophores, the above information is from Voss (1969) and Voss, et al. (1998).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circum-(sub)tropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical distribution

Type locality: Sagami Bay, Japan.

Figure. Distribution chart for S. dofleini. Modified from Voss et al. (1998). We have assumed that distribution records of Voss et al. (1998) off the west coast of the United States and the east coast of Japan belong to S. dofleini.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 91 specimens in 1 taxon.
Water temperature and chemistry ranges based on 80 samples.

Environmental ranges
  Depth range (m): 50 - 3500
  Temperature range (°C): 2.459 - 21.555
  Nitrate (umol/L): 0.122 - 36.298
  Salinity (PPS): 33.681 - 36.618
  Oxygen (ml/l): 1.868 - 6.208
  Phosphate (umol/l): 0.028 - 2.442
  Silicate (umol/l): 0.799 - 45.616

Graphical representation

Depth range (m): 50 - 3500

Temperature range (°C): 2.459 - 21.555

Nitrate (umol/L): 0.122 - 36.298

Salinity (PPS): 33.681 - 36.618

Oxygen (ml/l): 1.868 - 6.208

Phosphate (umol/l): 0.028 - 2.442

Silicate (umol/l): 0.799 - 45.616
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

A young S. dolfeini from off California (8 mm ML) has been described with the full compliment of photophores along the right eyelid and the distinctive flaps on the arms of the dorsal funnel organ (Voss, et al., 1992).


Figure. Ventral view of small S. dofleini, 8 mm ML, California Current. Drawing from Voss et al. (1992, fig. 143a).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Histioteuthis hoylei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTATATTTCATCTTTGGAATTTGAGCTGGATTACTAGGAACCTCTTTAAGATTAATAATTCGTACTGAACTTGGTCAACCAGGATCACTATTAAATGAT---GATCAACTATATAATGTTGTAGTAACCGCCCACGGTTTTATTATAATTTTCTTTTTAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTTCCTTTAATATTAGGAGCTCCCGATATAGCTTTCCCTCGAATAAACAATATAAGATTCTGACTTCTTCCTCCCTCCCTAACTTTACTTTTAACTTCCTCTGCTGTAGAAAGAGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTATCTAGAAATTTATCACACGCAGGACCTTCTGTTGACCTTGCTATTTTTTCTTTACATTTAGCAGGAGTCTCCTCAATTTTAGGAGCAATTAATTTTATTACAACAATTTTAAACATACGCTGAGAAGGTTTACAAATAGAACGTGTGCCACTCTTTGCATGATCTGTATTTATTACAGCTATTCTTTTGCTTCTATCCCTTCCAGTATTAGCAGGAGCAATCACCATACTTTTAACCGACCGAAATTTTAATACTACTTTTTTTGATCCTAGGGGGGGTGGGGATCCTATCTTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Histioteuthis hoylei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Histioteuthis hoylei

Histioteuthis hoylei, commonly called the flowervase jewel squid, is a species of cock-eyed squid. It is native to tropical and subtropical waters of the Indian and Pacific Oceans.[1] It grows to 20 cm in mantle length.[1] The eyes of this species are highly dimorphic.[2]

References

  1. ^ a b Norman, M.D. 2000. Cephalopods: A World Guide. ConchBooks, Hackenheim.
  2. ^ Young, R.E. 1975. Function of the dimorphic eyes in the midwater squid Histioteuthis dofleini. Pacific Science 29(2): 211–218.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!