Overview
Distribution
European waters (ERMS scope), FAO fishing area 37, Greek Exclusive Economic Zone, Mediterranean Sea, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Tyrrhenian Sea
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=124589
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
Trusted
Ecology
Habitat
demersal, shelf
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sepiola intermedia
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACTTTATACTTTATTTTTGGTATTTGATCTGGATTACTCGGAACTTCACTAAGTTTAATAATTCGGACTGAGTTAGGTAAGCCCGGCTCATTATTAAATGAT---GACCAATTGTATAATGTAGTAGTAACTGCACATGGTTTTATTATAATTTTTTTCTTAGTTATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTCCCTTTAATATTAGGGGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCCCTAACTTTACTTTTAGCTTCCTCAGCTGTGGAAAGGGGAGCAGGTACAGGTTGAACAGTATACCCCCCCTTATCTAGGAATATCTCACATGCGGGACCCTCAGTCGATTTAGCTATCTTTTCCCTTCATTTAGCTGGTGTTTCATCAATTTTAGGGGCTATTAATTTTATCACAACCATTATAAATATACGATGAGAGGGATTGCAAATAGAACGACTACCTTTATTCGTATGATCCGTTTTTATTACTGCTATTTTGTTATTATTATCCTTACCCGTATTAGCTGGTGCAATTACAATACTATTAACTGATCGAAATTTTAATACAACCTTTTTTGACCCTAGTGGGGGAGGGGATCCTATTTTATACCAGCATCTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sepiola intermedia
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
