Overview

Distribution

Range Description

This species occurs in the western and northern Mediterranean Sea (Reid and Jereb 2005). Its distribution includes Ligurian, Tyrrhenian, Adriatic and Aegean Seas (Reid and Jereb 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

demersal, shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Females attain a slight larger maximum body size (up to 28 mm in mantle length) compared to males (up to 26 mm in mantle length) (Reid and Jereb 2005). It usually occurs over muddy bottoms but off Italy (Tyrrhenian and Adriatic Seas) it is abundant on sandy bottoms (Reid and Jereb 2005). It also appears to rise up into the water column at night (Reid and Jereb 2005) presumably to feed. At least some spawning appears to occur throughout the year (Reid and Jereb 2005). Members of the subfamily Sepiolinae are bottom living species that typically bury in soft sediments during the day, and emerge at night to feed (Norman 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Depth range

8 to 110 m
  • Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepiola intermedia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATACTTTATTTTTGGTATTTGATCTGGATTACTCGGAACTTCACTAAGTTTAATAATTCGGACTGAGTTAGGTAAGCCCGGCTCATTATTAAATGAT---GACCAATTGTATAATGTAGTAGTAACTGCACATGGTTTTATTATAATTTTTTTCTTAGTTATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTCCCTTTAATATTAGGGGCCCCTGACATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCCCTAACTTTACTTTTAGCTTCCTCAGCTGTGGAAAGGGGAGCAGGTACAGGTTGAACAGTATACCCCCCCTTATCTAGGAATATCTCACATGCGGGACCCTCAGTCGATTTAGCTATCTTTTCCCTTCATTTAGCTGGTGTTTCATCAATTTTAGGGGCTATTAATTTTATCACAACCATTATAAATATACGATGAGAGGGATTGCAAATAGAACGACTACCTTTATTCGTATGATCCGTTTTTATTACTGCTATTTTGTTATTATTATCCTTACCCGTATTAGCTGGTGCAATTACAATACTATTAACTGATCGAAATTTTAATACAACCTTTTTTGACCCTAGTGGGGGAGGGGATCCTATTTTATACCAGCATCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sepiola intermedia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Sepiola intermedia has been assessed as Data Deficient as it is caught locally for food in the Mediterranean Sea where it is endemic, but little information is available as to catch statistics (as the species is not reported separately).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is caught in small scale, local fisheries (Reid and Jereb 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is required into trends in population size and the impacts of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!