Overview

Distribution

Range Description

This species ranges along the west coast of Africa from Cape Blanc, Mauritania in the north and southwards to Tigres Bay, Angola (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This very large species can reach a mantle length of up to 500 mm and total weight up to 7,500 g (Reid et al. 2005). Where their geographic distributions overlap, Sepia hierredda occurs in depths shallower than 50 m, whilst Sepia officinalis occurs in depths deeper than 100 m (Reid et al. 2005). It undergoes migrations and spawning is extended between February and September (Reid et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 48 - 62

Graphical representation

Depth range (m): 48 - 62
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sepia hierredda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GAGTTAGGTAAACCTGGTACACTTTTAAATGAT---GATCAACTTTACAACGTAGTAGTAACAGCACACGGTTTTATTATAATTTTTTTTTTAGTTATACCCATTATGATTGGAGGGTTTGGAAACTGATTAGTCCCTTTAATATTAGGTGCCCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTACCTCCATCACTCACTCTTTTATTATCTTCCTCCGCAGTTGAAAGAGGGGCAGGGACCGGTTGAACAGTATATCCCCCTTTATCTAGTAATTTATCTCACGCCGGTCCTTCAGTAGACTTAGCTATCTTCTCTCTTCATTTAGCCGGTGTTTCTTCAATTTTAGGGGCCATTAATTTCATTACAACTATTTTAAATATACGATGAGAAGGTCTACAAATAGAACGACTACCTCTATTTGCTTGATCAGTATTTATTACTGCCATCTTATTACTACTCTCCCTTCCCGTATTAGCTGGAGCTATTACAATACTATTAACTGATCGAAATTTTAAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sepia hierredda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Sepia hierredda has been assessed as Data Deficient as it is subject to intensive fishing pressure in certain regions (e.g. Western Sahara and Mauritania). It has previously been confused with S. officinalis (the only cuttlefish species for which separate FAO statistics are reported) and the lack of reliable FAO data makes it difficult to assess the current status of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Ocean acidification caused by increased levels of carbon dioxide in the atmosphere is potentially a threat to all cuttlefish. Studies have shown that under high pCO2 concentrations, cuttlefishes actually lay down a denser cuttlebone which is likely to negatively affect buoyancy regulation (Gutowska et al. 2010). It is commercially fished in the east central Atlantic. It is caught by Spanish fisheries off the Western Sahara and Mauritania (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is required into trends in population size and the impacts of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!