Overview
Distribution
East Atlantic, FAO fishing area 34, FAO fishing area 47, West Africa
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=124589
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sepia hierredda
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GAGTTAGGTAAACCTGGTACACTTTTAAATGAT---GATCAACTTTACAACGTAGTAGTAACAGCACACGGTTTTATTATAATTTTTTTTTTAGTTATACCCATTATGATTGGAGGGTTTGGAAACTGATTAGTCCCTTTAATATTAGGTGCCCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTACCTCCATCACTCACTCTTTTATTATCTTCCTCCGCAGTTGAAAGAGGGGCAGGGACCGGTTGAACAGTATATCCCCCTTTATCTAGTAATTTATCTCACGCCGGTCCTTCAGTAGACTTAGCTATCTTCTCTCTTCATTTAGCCGGTGTTTCTTCAATTTTAGGGGCCATTAATTTCATTACAACTATTTTAAATATACGATGAGAAGGTCTACAAATAGAACGACTACCTCTATTTGCTTGATCAGTATTTATTACTGCCATCTTATTACTACTCTCCCTTCCCGTATTAGCTGGAGCTATTACAATACTATTAACTGATCGAAATTTTAAC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Sepia hierredda
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
