Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 5.5 - 5.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cypraea spadicea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Neobernaya spadicea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTATATGATCAGGCTTAGTTGGAACGGCTCTTAGTTTATTAATTCGAGCGGAGCTGGGGCAACCGGGAGCCCTCTTGGGAGAT---GACCAGCTATATAATGTAATTGTAACTGCACACGCGTTTGTTATAATTTTCTTTTTAGTTATACCTATAATAATTGGAGGATTTGGGAATTGATTGGTTCCCCTAATATTAGGAGCCCCAGACATAGCTTTTCCTCGTTTAAATAACATGAGTTTTTGACTTTTACCTCCTGCCTTACTTCTTCTCCTTTCCTCAGCAGCTGTTGAGAGAGGTGTAGGAACAGGATGAACAGTTTATCCTCCTTTAGCAGGGAATCTTGCACATGCTGGGGGGTCTGTTGATCTTGCTATTTTTTCGTTACATCTTGCTGGTGTATCTTCTATTTTAGGTGCTGTAAATTTTATTACAACTATTATCAATATACGATGGCGAGGAATACAATTTGAACGACTTCCATTGTTTGTCTGATCTGTAAAAATTACAGCTGTTCTTCTCCTTCTTTCTTTGCCTGTACTAGCAGGAGCTATTACAATACTATTAACGGATCGAAATTTTAATACAGCCTTTTTTGATCCTGCAGGAGGTGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neobernaya spadicea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History and Raffles Museum, Singapore
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Neobernaya spadicea

Ventral view of live specimen of Neobernaya spadicea crawling on aquarium glass, anterior end to the bottom
Dorsal view of a shell of Neobernaya spadicea, anterior end to the top

Neobernaya spadicea, previously known as Cypraea spadicea, common name the chestnut cowrie, is a species of temperate sea snail, a cowry, a marine gastropod mollusk in the family Cypraeidae, the cowries.

Contents

Distribution

This species is a temperate cowry which occurs in the Eastern Pacific Ocean. It is relatively common in Southern California, particularly around the Channel Islands. It does occur from Monterey, California, through Southern California, and south to Cedros Island, in Baja California, Mexico, but north of Santa Barbara, California, it is not often found.

Shell description

The adult shell of this species ranges in size from 40 to 65 mm. The name "chestnut cowry" come from a large patch of a rich chestnut brown on the dorsum of the shell, ringed with a darker brown, against a white background.

Habitat

This species lives on exposed rocky shores in the very low intertidal and subtidal zones. It is found on overhanging rock ledges and on other somewhat sheltered rock surfaces.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!