Overview

Brief Summary

Introduction

Gonatus antarcticus was described by Lonnberg (1898) based on a stranded specimen near the Straits of Magellan (mm ML). He stressed that G. antarcticus difffered markedly form G. fabricii, which was the sole Gonatus species known at that time from the northern North Atlantic, by having greatly reduced marginal suckers, compressed hooks of arms I-III, and a little broader and differently shaped gladius. These characters stressed by Lonnberg may be due the comparison with the description of G. fabricii which was based on young individuals.

Diagnosis

A Gonatus with ...

  • large-size, slender mantle (MW=17-18% ML), long tail (ca. 20% of ML) and soft body.
  • long, narrow fins (FL=1/2ML), sagittate with round sides (FW=83% of FL).
  • long stout tentacles and small tentacle clubs (TCL=16-17% of ML)
  • tentacluar club with central large hook, middle-sized hook distal hook and 3-4 small proximal hooks with distal one largest and sizes decreasing proximally.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Gonatus antarcticus LÖNNBERG, 1898
(Figs. 3A–B, 4A–J)

 

 

Gonatus species: STEENSTRUP, 1882, p. 150.

 

Gonatus antarcticus LÖNNBERG, 1898, p. 51-55, pl. v.

 

Gonatus antarcticus: CLARKE, 1980, p. 138-142, text-fig. 103.

 

Material examined: NSMT Mo-63957, Lat. 47º24'S, Long. 59°37'W, north of Forkland Islands in the South Atlantic Ocean, bottom trawl at about 928 m depth, “BANSHU-M ARU”, Japan Marine Fishery Resource Research Center (October 13, 1984). Deposited in National Science Museum, Tokyo.

 

Specimen deposited in the U.S. National Museum of Natural History, Smithsonian Institution, Lat. 40º18'S, Long. 35°07'W, South Atlantic Ocean (September 3, 1971).

 

Specimen deposited in Zoological Museum, Copenhagen, SAM A6514, locality unknown, date unknown. See measurements for size (Table 3).

 

Diagnosis: A gonatid with slender body (MW/DML= 18%), short arms (AL/DML =45%) and sagittate fins (FW/FL= 84%). Suckers in outer rows of Arms I, II, III are ⅔ smaller in size than those of Arm IV. Tentacular manus with a large central hook, a medium-sized distal hook and 3-4 small proximal hooks remarkably decreasing in size proximally.

 

Description: Mantle is slender, cylindrical in the anterior half, but gently tapering posteriorly to the blunt end of gladius cone from which a long gelatinous tail continues to the posterior end of the fin. Mantle wall is moderately thick and muscular but soft to touch. Ventral excavation is shallow (Fig. 3A).

 

Body is covered with a thin epidermis densely spotted with purplish chromatophores on ventral and aboral surfaces but epidermis is easily torn off by handling.

 

Fins are sagittate with roundish sides. Fin length is about half of the DML, FW/FL being about 84%. Posterior margins are slightly concave, but anterior margins are convex with small lobe to the fin base.

 

Head is squarish, slightly narrower than the mantle opening. Eyes are large, oc­cupying almost entire lateral sides of the head with distinct sinus on the orbit. Neck is moderately constricted with two pairs of olfactory crests, one situated near the funnel groove and the other on dorso-lateral sides.

 

Funnel is moderate in size, reaching the posterior level of the eye lenses with smooth funnel groove. Funnel cartilages are lanceolate with rounded ends, about 9.5% of DML. Median groove is almost straight, widened anteriorly (Fig. 4J). Mantle locking carti­lages are linear ridges, nearly of the same length as the corresponding funnel cartilages. Funnel organs are not observed.

 

Nuchal cartilage is rectangular with rounded ends, about 10% of DML in length, 3% of DML in width. Three straight grooves run along the longitudinal axis of the cartilage.

 

Arms are short, 40-45% of DML, stout proximally and tapering to the distal tips. Arm formula is IV, II=III, I, but the difference in length is not prominent. Arm IV has a thin lateral keel. Right Arm III of NSMT Mo-63957 shows regeneration of in­jured arm tip.

 

Arm armature is quadriserial. Median two rows of Arms I, II, III consist of hooks, arranged in a zigzag row. Marginal rows consist of small suckers arranged likewise. Hooks are covered with fleshy hood, connnected to the oral surface of the arm by short pedicel. Marginal suckers are situated at the distal end of long trabecula which supports a thin protective membrane along the margins of oral surface of the arms (Fig. 4I). Median two rows of Arm IV are not modified into hooks and this arm has quadriserial suckers throughout. The median and marginal suckers of Arm IV are nearly the same in size. Marginal suckers of Arms I, II and III are smaller, about ⅔ of the suckers of Arm IV. Both hooks and suckers decrease in size distally. Armatures in a proximal half length of the arms vary from 20 suckers plus 17 hooks in Arm I to 24 suckers plus 20 hooks each in Arms II and III. That of Arm IV is 44-46 suckers. Marginal suckers at the middle portion of Arms I, II and III have 6-9 pointed teeth on the distal margin of chitinous rings with smooth proximal margin (Fig. 4A-C). Chitinous rings of both marginal and median suckers of Arm IV have 7-8 pointed teeth (Fig. 4D-E).

 

Tentacles are long, stout and as long as DML, with medium-sized tentacular club. Tentacular stalk is nearly rectangular in cross section.

 

Tentacular club is about 15% of DML, having a large hook at the central portion of manus with a small hook, about ⅓ of the largest one, distal to it. Proximal to the large central hook, 3-4 much smaller hooks and/or suckers continue longitudinally, with a remarkable decrease in size proximally. Manus formula HHhhhh or HHhhhs or HHhhss. Dactylus has a well-defined dorso-aboral keel (Fig. 3B). Suckers on dactylus are about 150-160 in number, 4-5 rows densely beset, terminating in a circle at the tip. Suckers on dactylus have 4-5 rounded teeth on the distal margin of the chitinous ring (Fig. 4G). Suckers on dorso-marginal zone of manus are about 50-60 in number, con­tinuing to the inner carpal group. Suckers on dorso-marginal zone have 6-7 blunt teeth (Fig. 4F). Ventro-marginal zone of manus consists of 14-15 trabeculae connected with a thin membrane, each of them bears 3-4 suckers, continuing to the ventral marginal suckers of tentacular stalk in a single row. Ventro-marginal suckers have 7 blunt teeth (Fig. 4H). Carpal group consists of 5-6 large, smooth-ringed suckers set alternately on a thick ridge with fleshy knobs. Proximal to the carpal group, a series of alternating small, smooth-ringed suckers and pads continues almost in entire length of oral-dorsal margin of the tentacular stalk. Between ventral and dorsal marginal suckers of tentacular stalk, about 120-140 small suckers are scattered near the base of stalk.

 

 

Table 3. Measurements of Gonatus antarcticus LÖNNBERG, 1898 in mm.

                                                                                                                                                                                                                                                                                  
 

Characters

 
 

NSMT Mo-63957

 
 

Specimen in USNM

 
 

Specimen in Zool. Mus. Copen.

 
 

Sex

 
 

-

 
 

-

 
 

female

 
 

DML

 
 

230

 
 

235

 
 

218

 
 

Tail L

 
 

50

 
 

52

 
 

54

 
 

MW

 
 

40

 
 

42

 
 

44

 
 

FL

 
 

114

 
 

103

 
 

101

 
 

FW

 
 

95

 
 

84

 
 

89

 
 

FBL

 
 

100

 
 

-

 
 

-

 
 

HL

 
 

28

 
 

35

 
 

33

 
 

HW

 
 

32

 
 

28

 
 

35

 
 

ED

 
 

22

 
 

-

 
 

24

 
 

NCL

 
 

23

 
 

-

 
 

22

 
 

NCW

 
 

7

 
 

-

 
 

8.5

 
 

FCL

 
 

22

 
 

-

 
 

21

 
 

FCW

 
 

5.8

 
 

-

 
 

7.0

 
 

AL

 
 

right

 
 

I

 
 

90

 
 

103

 
 

74*

 
 

 
 

 
 

II

 
 

92

 
 

110

 
 

110

 
 

 
 

 
 

III

 
 

70**

 
 

113

 
 

105

 
 

 
 

 
 

IV

 
 

104

 
 

104

 
 

108

 
 

 
 

left

 
 

I

 
 

88

 
 

-

 
 

91

 
 

 
 

 
 

II

 
 

91

 
 

-

 
 

115

 
 

 
 

 
 

III

 
 

91

 
 

-

 
 

114

 
 

 
 

 
 

IV

 
 

102

 
 

-

 
 

110

 
 

1/2AAC

 
 

right

 
 

I

 
 

20s/1s+17h

 
 

22s/19h

 
 

-

 
 

 
 

 
 

II

 
 

22s/1s+19h

 
 

24s/2s+21h

 
 

-

 
 

 
 

 
 

III

 
 

18s/13h**

 
 

22s/2s+20h

 
 

-

 
 

 
 

 
 

IV

 
 

44s

 
 

50s

 
 

-

 
 

 
 

left

 
 

I

 
 

18s/1s+17h

 
 

-

 
 

21s/2s+20h

 
 

 
 

 
 

II

 
 

24s/1s+20h

 
 

-

 
 

22s/2s+20h

 
 

 
 

 
 

III

 
 

22s/1s+21h

 
 

-

 
 

21s/2s+21h

 
 

 
 

 
 

IV

 
 

46s

 
 

-

 
 

50s

 
 

TL

 
 

right

 
 

240

 
 

280

 
 

150

 
 

 
 

left

 
 

238

 
 

-

 
 

145

 
 

TCL

 
 

right

 
 

35

 
 

33

 
 

35

 
 

 
 

left

 
 

34

 
 

-

 
 

34.8

 
 

DSC

 
 

150-160

 
 

160-170

 
 

-

 
 

DMSC

 
 

50-60

 
 

70-80

 
 

-

 
 

VMSC

 
 

50-60

 
 

55-65

 
 

-

 
 

TCAF

 
 

HHhhhs

 
 

HHhhss

 
 

HHhhhh

 
 

DML, dorsal mantle length; Tail L, tail length; MW, mantle width; FL, fin length; FW, fin width; FBL, fin base length; HL, head length; HW, head width; ED, eye diameter; NCL, nuchal cartilage length; NCW, nuchal cartilage width; FCL, funnel cartilage length; FCW, funnel cartilage width; AL, arm length; l/2AAC, proximal half length of arm armatures count, expressed marginal suckers/midian suckers+hooks; TL, tentacle length; TCL, tentacular club length; DSC, dactylus sucker count; DMSC, dorso-marginal sucker count; VMSC, ventro-marginal sucker count; TCAF, Tenta­cular club armatures formula expressed in the number of hooks or suckers from distal to proximal with symbols H indicating the distal large hook, H, the central large hook, h, the proximal small hook and s, the proximal small sucker. * arm tip lacking; **regenerated arm.

 

 

Buccal membrane has 7 lappets, connected to the dorsal borders of Arms I and II, and to the ventral borders of Arms III and IV, being of DDVV-type. Outer lip is thin, darkly pigmented. Inner lip is thick, muscular with numerous small fleshy warts.

 

Beaks, radula, gladius and viseral organs were not observed because of scarcity of available specimens.

 

Discussion: Among the known Gonatus species, G. antarcticus is considered to be closely related to G. fabricii - G. steenstrupi complex in the North Atlantic and G. californiensis in the Northeast Pacific (KRISTENSEN, 1981; YOUNG, 1972). According to LÖNNBERG (1898), G. antarcticus has greatly reduced marginal suckers and compressed hooks on Arms I–III. The relative smallness of marginal suckers of Arms I–III in com­parison with that of Arm IV was recognized in the present specimen. However, the expression of "greatly reduced" seemed to be somewhat exaggerated. In the recent systematic study of Atlantic Gonatus, KRISTENSEN (1981) pointed out that G. antarcticus has very strong tentacles with numerous (118-190) small suckers on the median portion of the tentacular stalk and rather small clubs with more numerous suckers (270) than in any other Gonatus species. These characters were confirmed in the present study. KUBODERA and OKUTANI (1981) calculated some bodily proportions of seven Gonatus species. From their table, it is clear that G. antarcticus has comparatively narrower fins than other Gonatus species. IMBER (1978) considered that G. californiensis is synonymous with G. antarcticus and suggested that the ranges of the two populations are almost certainly confluent via the eastern central Pacific. However, G. californiensis is clearly distinguishable from G. antarcticus by the characters mentioned above.

 

The present study revealed that the arrangement of hooks on the proximal portion of the central large hook of manus apparently separates G. antarcticus from others. G. antarcticus has 3-4 hooks proximal to the central large hook among which the most distal one is the largest and decreasing rapidly in size proximally. Such a serial decrease in size of the hooks distal to the central large hook has never been seen in other Gonatus species in the Northern Hemisphere. This character is equally observed in three speci­mens examined and considered to be one of the important specific characters of G. ant­arcticus.”

 

 

(Kubodera & Okutani, 1986: 135-140)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

  1. Arms
    1. Short (40-50% of ML), thick amd muscular.
    2. Arm formula IV, II=III, I, but differences in lengths not prominent.
    3. Arm IV with thin lateral keels and arm III with swimming keel along entire lengths.
    4. Number of hooks and suckers on 1/2 arm III 20-21 and 21-22, respectively.

      Photo. Gonatus antarcticus (ca. 22cm ML): deposited in South African Museum, Cape Town. Lavel indicates this specimen was identified into G. fabricii but judging from the locality this specimen should be G. antarcticus.

  2. Tentacles
    1. Tentacle long (TL=ML) with relatively small club (TCL=16-17% ML).
    2. Large central hook with medium-sized distal hook.
    3. 3-4 hooks proximal to central large hook, distal one largest and decreasing in size rapidly proximally.
    4. Numerous small suckers on the median portion of the tentacular stalk.

    5. Figure. Oral views of the tentacle and club of G. antarcticus. Top - Tentacle, 230 mm ML, NSMT-Mo 63957. Drawings from Kubodera & Okutani (1986). Bottom - Club, 113 mm ML. Photograph by R. Young.

  3. Head
    1. Almost squarish in shape, slightly narrower than mantle opening.
    2. Funnel cartilage lanceolate in shape; nuchal cartilage rectangular with three grooves.

  4. Fins and tail
    1. Fins long, narrow (FL=1/2ML), sagittate with round sides (FW=83% of FL).
    2. Long tail (ca. 20% of ML).

  5. Photophores
    1. Photophores absent.

Comments

Gonatus antarcticus is considered to be closely related to Gonatus species in the North Atrantic, i. e., G. fabricii and G. steenstrupi on the basis of external morphology. Imber (1978) considered that G. californiensis might be a synonym of G. antarcticus without reliable information. Tentacluar club structure and number of suckers on the tentacular stalk of G. californiensis apparently differ from G. antarcticus. Complete absence of Gonatus in tropical waters indicates that this group has a distinct bipolar distiribution. Imber (1978) also described G. phoebetriae based on a single lower beak form the stomach contents of sooty albatross from off New Zealand. However, the validity of G. phoebetriae is very dubious due to incomplete comparison among beaks in the families and considered to be a species dubium. G. antarcticus is the sole Gonatus species distributed in the southern hemisphere.

More details of the description of G. antarcticus can be found here.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The known distribution of Gonatus antarcticus extends from approximately 70ºW to 30ºE in the Atlantic sector of the Southern Ocean at around 40ºS, although its distribution may be circumpolar (Kubodera 2006). It is also the only Gonatus species in the southern hemisphere (Kubodera 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The distribution of G. antarcticus is primarily in the Atlantic sector of Antarctic waters around the Antarctic Convergence at 40 S. More details of the distribution are found here.


Figure. Distribution of G. antarcticus. Dark pink area indicates known range; this species may have circum-antarctic distribution. Chart modified from Okutani (2005).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species attains some of the largest body sizes (up to 400 mm in mantle length) observed amongst gonatid squids. Off the Falkland Islands, both mating and spawning appear to occur off the bottom at mid depths (Laptikhovsky et al. 2007). For example, two spent females (380 and 395 mm in mantle length) were caught at between 976 and 1,000 m in depth over bottom depths of 1,848-2,381 m (Laptikhovsky et al. 2007). Similarly, mature/spent males were also caught at depths of between 700 and 750 m over bottom depths of 905-1,017 m (Laptikhovsky et al. 2007). Interestingly, the spent females also showed signs of having brooded an egg mass in their arms like G. onyx (Laptikhovsky et al. 2007). Mature females had ovaries containing 10-25,000 oocytes (3.2-3.3 mm in length), and all of these eggs were developing synchronously suggesting spawning occurs over a short period of time (Laptikhovsky et al. 2007). Juvenile stages are caught in near surface waters (0-200 m) (Laptikhovsky et al. 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 98 - 2100
  Temperature range (°C): 2.122 - 11.276
  Nitrate (umol/L): 8.421 - 35.330
  Salinity (PPS): 34.231 - 34.784
  Oxygen (ml/l): 3.776 - 5.905
  Phosphate (umol/l): 0.754 - 2.406
  Silicate (umol/l): 3.399 - 93.614

Graphical representation

Depth range (m): 98 - 2100

Temperature range (°C): 2.122 - 11.276

Nitrate (umol/L): 8.421 - 35.330

Salinity (PPS): 34.231 - 34.784

Oxygen (ml/l): 3.776 - 5.905

Phosphate (umol/l): 0.754 - 2.406

Silicate (umol/l): 3.399 - 93.614
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus antarcticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTACTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTGGGACAACCTGGCTCTCTACTAAACGAC---GATCAACTTTATAACGTTGTAGTCACAGCCCATGGATTTATCATAATTTTTTTTTTGGTCATGCCTATCATAATTGGAGGATTTGGTAATTGACTTGTACCCTTAATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGATTATTACCACCTTCCTTAACACTATTACTAGCTTCCTCAGCCGTTGAAAGTGGGGCAGGTACAGGATGAACAGTCTACCCCCCTCTTTCTAGCAACTTATCTCATGCAGGACCTTCAGTTGATTTAGCCATTTTTTCTTTACACCTAGCAGGTGTATCCTCCATTCTAGGAGCCATTAACTTCATTACTACAATTTTAAACATGCGATGAGAAGGGCTACAAATGGAACGACTACCCCTTTTTGCTTGATCTGTGTTTATTACCGCAATCTTACTACTTTTATCACTTCCTGTTTTAGCCGGAGCTATTACTATACTATTAACTGACCGAAACTTTAACACAACCTTTTTTGACCCTAGGGGAGGAGGGGATCCCATCTTATACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus antarcticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Vecchione, M., Young, R. & Böhm, M.

Contributor/s
Duncan, C. & Carrete-Vega, G.

Justification
Gonatus antarcticus has been assessed as Least Concern, due to its widespread distribution where it is unlikely to be impacted by human activities. As an Antarctic species it is protected by the Antarctic Treaty System, offering it some protection. However, further research is recommended in order to determine the population dynamics, life history and ecology, and potential threat processes affecting this species
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
As an Antarctic species, it is protected by the Antarctic Treaty System. There are no species-specific conservation measures in place for this species. Further research is recommended in order to determine the precise distribution, population dynamics, life history and ecology, and potential threat processes affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gonatus antarcticus

Gonatus antarcticus is a squid in the family Gonatidae. The species is known with certainty only from southern Atlantic waters but it may have a circum-Antarctic distribution.[1]

References

  1. ^ Kubodera, T. (2006). Gonatus antarcticus Lönnberg 1898. Tree of Life Web Project.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!