Overview

Brief Summary

There are six living species of nautilus. They are called “living fossils” because they have existed for about 550 million years. Nautiluses live in shells that are divided into chambers. As they grow, they move into a new, larger chamber and close the old one. The Chambered Nautilus is the most common nautilus. It lives in the South Pacific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sebastian Velvez

Supplier: Life on Earth

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

3.1. Nautilus pompilius Linnaeus, 1758

 

 

3.1.1. Diagnosis

 

 

Mature shell size variable, but typically about 165 mm (Philippines), with a total weight (body plus shell) of about 850 g. Shell has a small umbilicus (≈ 5% of shell diameter), filled with a callus (with rare exceptions); shell coloration variable, but generally comprises irregularly radiating brown stripes that extend from umbilicus to venter.

 

 

3.1.2. Discussion

 

 

The type species of the genus (and the most common and widely distributed), N. pompilius appears to exhibit the greatest range in variation (Fig. 4). The di­ameters of 234 mature specimens caught during the 1979 ALPHA HELIX Expe­dition to the Tañon Straits, the Philippines, ranged from 150 mm (mature female) to 188 mm (barely mature male), with a mean of 165 mm. Sexual dimorphism is shown by slightly smaller females (mean diameter 160 mm) compared to males (mean 170 mm). Specimens of this species (provided by D. Dan) purported to have been caught live, off Tubbataha Reef, central Sulu Sea, the Philippines (Fig. 3C and D), are the smallest known representatives of this species, ranging from 103 to 126 mm in mature shell diameter, with a mean of 114 mm (N = 29). In Papua New Guinea, the average mature size of geographically isolated populations of N. pompilius varies considerably, from 144 mm (Lae, on the north coast of Papua New Guinea) to 169 mm (Kavieng, New Ireland Province), with an overall range in individual (mature) size of 124-199 mm in diameter (Saunders and Davis, 1985). Specimens of this species from Queensland average 153 mm in diameter (N = 5). The cause for the wide range in variation in mature size is not known; it may be genetic, or it may be related to ecological factors.

 

Variation in the pattern of shell coloration is manifest as differences in the amount of coloration, hue, degree of coalescence of banding over the venter, and development of color bands in the vicinity of the umbilicus. There appears to be a trend toward an increased proportion of shells with a white umbilical region, going southward through Papua New Guinea toward Australia (compare Fig. 2B, C, D).

 

The number of specimens with an open umbilicus (i.e., lacking an umbilical callus) does not appear to vary systematically; typically, fewer than 0.025% of live-caught N. pompilius in the Philippines and in Papua New Guinea show this curious abnormality (see also Mapes et al., 1979). In N. pompilius, the umbilical callus is secreted during the growth of the second whorl, at approximately 75- mm diameter in Philippine specimens.

 

 

3.1.3. Distribution

 

 

In his description of N. pompilius, Linnaeus stated only that it "inhabits the Indian and African Ocean" (Turton, 1806, p. 305). However, because his reference to an illustration was that of Rumphius (1741, Plate 17, Figs. A–C), Amboina (Ambon), Indonesia (the source of the specimens illustrated by Rumphius), is the type locality for the species. Nevertheless, this species is best known from the Philippines, and it has been the subject of a number of studies (e.g., Griffin, 1900; Dean, 1901; Bidder, 1962; Haven 1972, 1977a,b; Hayasaka et al., 1982; Hayasaka, 1983: Cochran et al., 1981; Ward and Chamberlain, 1983; Arnold, 1985), particularly in the Tañon Straits, between Cebu and Negros, which was the site of research expeditions, based on the R/V ALPHA HELIX, in 1975 and 1979.*

 

Occurrences of N. pompilius in Fiji have been reported by Moseley (1892), Davis and Mohorter (1973), Ward et al. (1977), Ward and Martin (1980), Masuda and Shinomiya (1983), Zann (1984), and Hayasaka (1985). A single live animal is captured off Kagoshima Bay, south Japan (Tanabe and Hamada, 1978; JE-COLN, 1980b). Other reports substantiate the existence of living populations in the Andaman Islands (Smith, 1887) and the New Hebrides (Owen, 1832; Bennett, 1834), and this species is widely distributed in the Papua New Guinea region, including New Britain, New Ireland, Manus, Lae, and Port Moresby (Willey, 1895, 1896, 1897a,c, 1898a, 1899, 1902; Saunders and Davis, 1985; Saunders et al., 1987a). The existence of living N. pompilius from the Great Barrier Reef, Australia, has been established just recently with the capture of six specimens off Lizard Island, Queensland, at depths of 200-400 m (Saunders and Ward, 1987), and in 1986, 39 specimens were trapped outside Pago Pago Harbor, American Samoa (Saunders et al., 1987b). The even wider distribution of drifted shells of N. pompilius (see Chapter 4) makes it certain that many more occurrences remain to be discovered.

 

 

* For results of these expeditions, see the Journal of Experimental Biology, Vol. 205 (1978), and Pacific Science, Vol. 36 (1982).”

 

 

(Saunders, 1987: 39-41)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Nautilus pompilius is found in the Indo-Pacific area. They primarily live near the bottom, in waters up to 500 meters deep, but rise closer to the surface throughout the night.

(Morton 1979)

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Central Indo-Pacific, Chagos, FAO fishing area 57, FAO fishing area 71, Madagascar
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Nautilus pompilius can grow to a length of about 20 cm. The smooth thin shell spirals exogastrically, or above the animal, and has a pattern of brown and white. The animal creates chambers that increase in size as it moves to occupy the outermost chamber of its shell. An adult may have about 30 of these chambers. A tube called a siphuncle runs down the center of these chambers releasing a gas to maintain buoyancy and to keep N. Pompilius in an upright position. There is a tough hood where the anterior of its body connects to the shell. Below the hood protrudes about 90 small suckerless tentacles. Beneath, there is a funnel containing two separate lobes. The eyes contain no cornea or lens.

(Attenborough 1979, Morton 1979, Brusca and Brusca 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

They live along the bottom of the shores and coral reefs of the South Pacific.

(Abbot 1935)

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 2 taxa.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 150 - 360
  Temperature range (°C): 16.084 - 16.374
  Nitrate (umol/L): 8.806 - 16.111
  Salinity (PPS): 35.267 - 35.312
  Oxygen (ml/l): 3.651 - 3.749
  Phosphate (umol/l): 0.812 - 0.915
  Silicate (umol/l): 4.233 - 4.736

Graphical representation

Depth range (m): 150 - 360

Temperature range (°C): 16.084 - 16.374

Nitrate (umol/L): 8.806 - 16.111

Salinity (PPS): 35.267 - 35.312

Oxygen (ml/l): 3.651 - 3.749

Phosphate (umol/l): 0.812 - 0.915

Silicate (umol/l): 4.233 - 4.736
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Due to its primitive eyes and sensitivity to light, N. pompilius relies on its sense of smell to detect the fishes and crabs that it feeds on. They also feed on carrion.

(Attenborough 1979, Morton 1979)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

This species reproduces sexually through internal fertilization and reaches sexual maturity at age 15 to 20 years. Four of the tentacles on the male form the spandix, which transfers sperm by means of a spermatophore. A spermatophore contains an elongated sperm mass that adheres to the female's mantle wall. The protective coating disintegrates, releasing the sperm. They then lay oblong eggs that are around 1.5 inches in length. The newly hatched chambered nautilus has a small shell that is about one inch in diameter.

(Brusca and Brusca 1990, Dybas 1994)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nautilus pompilius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGGACTCTTTACTTTTTATTCGGAATTTGGTCCGGTTTAGTCGGAACATCTCTTAGTTTATTAATTCGAACAGAATTAAGACAACCTGGAACTCTTTTAGGAGAT---GACCAATTATATAATGTAATCGTTACAGCTCACGCCTTTGTTATGATTTTCTTCCTAGTAATACCAATCATGATTGGAGGCTTTGGTAATTGACTCTTGCCCCTTATGTTAGGAGCACCAGATATAGCCTTCCCCCGACTAAACAACATAAGATTCTGACTTCTACCCCCATCCTTAATGTTACTACTATCTTCCGCCGCAGTCGAAAGAGGAGCAGGAACTGGATGAACAGTATACCCCCCATTATCAGATAACTTAGCTCATGCTGGACCATCAGTAGATTTAGCAATTTTTTCACTACACTTAGCTGGAGTCTCGTCAATCTTAGGAGCATTAAACTTCATCACCACTATTATTAATATGCGATGAAAAGGCCTTCAATTAGAGCGCATACCTTTATTTGTATGGTCTGTAAAAATTACAGCAATCCTCTTACTTCTATCACTACCTGTCTTAGCAGGGGCCATCACTATGTTACTAACAGATCGTAACCTCAATACTTCATTTTTCGATCCAGCTGGAGGAGGAGATCCAATTCTTTATCAACACTTATTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nautilus pompilius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 419
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Researchers study N. pompilius for many reasons. First, there is a process called biominetrics that strives to synthetically produce such organic materials as nacre, or the mother of pearl that lines the inside of N. pompilius' shell. This thin coating is incredibly strong, and this synthesized material would be used in small machines. Researchers are mainly interested in understanding how these materials are made naturally. In addition, N. pompilius has the most highly developed pinhole eyes, making them the subject of much research. This relatively uncommon eye type lacks lenses.

(Clery 1992, Nilsson 1989)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chambered nautilus

The chambered nautilus, Nautilus pompilius, is the best-known species of nautilus. The shell, when cut away, reveals a lining of lustrous nacre and displays a nearly perfect equiangular spiral, although it is not a golden spiral. The shell exhibits countershading, being light on the bottom and dark on top. This is to help avoid predators, because when seen from above, it blends in with the darkness of the sea, and when seen from below, it blends in with the light coming from above.

The chambered nautilus has more primitive eyes than some other cephalopods; the eye has no lens and thus is comparable to a pinhole camera. The species has about 90 tentacles with no suckers, which is also different from other cephalopods. Chambered nautiluses have a pair of rhinophores, which detect chemicals, and use olfaction and chemotaxis to find their food.[not verified in body]

The oldest fossils of the species are known from Early Pleistocene sediments deposited off the coast of Luzon in the Philippines.[1]

Recently, scientists have become alarmed at declining populations of nautilus resulting from overfishing, and are studying world populations to determine the need for protection under the United Nations Convention on International Trade in Endangered Species.[2]

Contents

Subspecies

Two subspecies of N. pompilius have been described: N. p. pompilius and N. p. suluensis

N. p. pompilius is by far the most common and widespread of all nautiluses. It is sometimes called the emperor nautilus due to its large size. The distribution of N. p. pompilius covers the Andaman Sea east to Fiji and southern Japan south to the Great Barrier Reef. Exceptionally large specimens with shell diameters up to 268 mm (10.6 in)[3][4] have been recorded from Indonesia and northern Australia. This giant form was described as Nautilus repertus, but most scientists do not consider it a separate species.

N. p. suluensis is a much smaller animal, restricted to the Sulu Sea in the southwestern Philippines, after which it is named. The largest known specimen measured 160 mm in shell diameter.[5]

In literature and art

16th-century Northern Mannerist nautilus cup
Nautilus shells engraved to commemorate Horatio Nelson, displayed at Monmouth Museum
A nautilus shell was used to fashion this drinking cup depicting Atlas, a legendary titan of Greco-Roman mythology.[6]

Nautilus shells were popular items in the Renaissance cabinet of curiosities and were often mounted by goldsmiths on a thin stem to make extravagant nautilus shell cups, such as the Burghley Nef, mainly intended as decorations rather than for use. Small natural history collections were common in mid-19th-century Victorian homes, and chambered nautilus shells were popular decorations.

The chambered nautilus is the title and subject of a poem by Oliver Wendell Holmes, in which he admires the "ship of pearl" and the "silent toil/That spread his lustrous coil/Still, as the spiral grew/He left the past year's dwelling for the new." He finds in the mysterious life and death of the nautilus strong inspiration for his own life and spiritual growth. He concludes:

Build thee more stately mansions, O my soul,
As the swift seasons roll!
Leave thy low-vaulted past!
Let each new temple, nobler than the last,
Shut thee from heaven with a dome more vast,
Till thou at length art free,
Leaving thine outgrown shell by life's unresting sea!

A painting by Andrew Wyeth, entitled "Chambered Nautilus", shows a woman in a canopied bed; the composition and proportions of the bed and the window behind it mirror those of a chambered nautilus lying on a nearby table.

The popular Russian rock band Nautilus Pompilius (Наутилус Помпилиус) is named after the species.

American composer and commentator Deems Taylor wrote a cantata entitled The Chambered Nautilus in 1916.

The chambered nautilus is often used as an example of the golden spiral. While nautiluses show logarithmic spirals, their ratios range from about 1.24 to 1.43, with an average ratio of about 1.33 to 1. The golden spiral's ratio is 1.618. This is actually visible when the cut nautilus is inspected.

References

  1. ^ Ryoji, W.; et al (2008). "First discovery of fossil Nautilus pompilius (Nautilidae, Cephalopoda) from Pangasinan, northwestern Philippines". Paleontological Research 12 (1): 89–95. doi:10.2517/1342-8144(2008)12[89:FDOFNP]2.0.CO;2. 
  2. ^ Broad, William (24 October 2011). "Loving the Chambered Nautilus to Death". The New York Times. Archived from the original on 24 October 2011. Retrieved 24 October 2011. 
  3. ^ Nautilus repertus ID:118764. Shell Encyclopedia, Conchology, Inc.
  4. ^ Harasewych, M.G. & F. Moretzsohn (2010). The Book of Shells: A lifesize guide to identifying and classifying six hundred shells. A & C Black Publishers, London.
  5. ^ Nautilus pompilius suluensis ID:626793. Shell Encyclopedia, Conchology, Inc.
  6. ^ "Nautilus Cup". The Walters Art Museum. 
  • Norman, M. 2000. Cephalopods: A World Guide. Hackenheim, ConchBooks, pp. 30–31.
  • Pisor, D. L. (2005). Registry of World Record Size Shells (4th edition ed.). Snail's Pace Productions and ConchBooks. p. 93. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!