Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is commonly distributed throughout Canada and the U.S. in the Mississippi, Great Lakes, and Hudson Bay basins. It also occurs in the Gulf of Mexico drainage area of Louisiana and Texas, and in the Red River drainage in Texas and Oklahoma. It has been introduced to some areas as glochidia on stocked fish hosts (Upper Lake Mary, Arizona- Hovingh, 2004; tidal Hudson River in Haverstraw, New York- Mills et al., 1996). In the Apalachicola Basin (ACF basin = formed by Apalachicola, Chattahoochee, and Flint Rivers) of Alabama, Florida, and Georgia, this species is historically known from 59 records from 29 sites and was considered widespread throughout the ACF system including the main channel and tributaries of the Apalachicola, Chipola, Chattahoochee, and Flint Rivers (Brim Box and Williams, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is a widespread species across thirty two states: Alabama, Arizona, Arkansas, Colorado, Florida, Georgia, Illinois, Indiana, Iowa, Kansas, Kentucky, Louisiana, Michigan, Minnesota, Mississippi, Missouri, Montana, Nebraska, New York, North Carolina, North Dakota, Ohio, Oklahoma, Pennsylvania, South Dakota, Tennessee, Texas, Vermont, Virginia, West Virginia, Wisconsin, Wyoming in the United States of America (NatureServe 2009). It is also present in Alberta, Manitoba, Northwest Territories, Nunavut, Ontario, Quebec, Saskatchewan in Canada and Northern Mexico (Brim Box and Williams 2000, NatureServe 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The giant floater is a widespread species, found throughout te Mississippi and Missouri river drainages, the St. Lawrence drainage,, Gulf of Mexico through Louisiana and Texas. In Canada it is in the Interior basin from western Ontario to Alberta.

In Michigan, P. grandis is found throughout streams, lakes and rivers in the state. In general, it is more common in lakes, but is widespread throughout river systems.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The giant floater is up to 25.4 cm (10 inches) long , and is elliptical or elongated in shape. The shape often varies. The shell is usually fairly thin and inflated. The   anterior end is broadly rounded, the posterior end bluntly pointed. The dorsal hinge line is slightly curved and the ventral margin is straight or slightly curved.

Umbos are full, raised slightly above the hinge line and are situated slightly towards the anterior part of the shell. The beak sculpture has three to five double-looped ridges.

The periostracum (outer shell layer) is smooth, yellow to yellow-green with rays in younger individuals. Older specimens tend to be more brown.

On the inner shell, the   left valve lacks   pseudocardinal and lateral teeth. There is a slight thickening sometimes where the lateral tooth would be.

The beak cavity is broad and shallow. The nacre varies from silvery white, yellow, pink or copper.

In Michigan, this species can be confused with Pyganodon lacustris, paper pondshell, creeper, and cylindrical papershell. Pyganodon lacustris is generally more elongate. The paper pondshell has flattened umbos. The creeper may have a slightly waved and thickened hinge. The cyclindrical papershell generally has a beak sculpture of concentric, single loops.

Range length: 25.4 (high) mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 12 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Large, somewhat thicker-shelled than congeners, variable, umbones above hingeline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species inhabits permanent ponds, lakes, and rivers of various sizes, usually on mud but also found on other substrates; 0.2 m water depth and beyond. It attains its greatest abundance and individual size in reservoirs, lakes and ponds having a mud bottom with little or no current but is tolerant of slow flowing pool area of rivers of all sizes (Parmalee and Bogan, 1998). It is more tolerant of low oxygen levels than other unionid species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This generalist species is found in small shallow streams, 'high in conductivity, with a fine sediment cover and detritus' as well as headwater creeks in marshes, pools, the margins of streams and backwater areas (Gagnon et al. 2006). Impoundments, lakes and pools that have mud bottoms with little or no current enable this species to become abundant and attain the largest possible size for this species, along with its tolerance for sedimentation and pollution (Parmalee and Bogan 1998, NatureServe 2009). It also has a large number of host fish which can further explain the wide distribution and large populations of this species (Parmalee and Bogan 1998).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The giant floater is found in all habitats, but mainly in lakes or slower moving waters, including backwaters of streams, rivers, and impoundments. It can colonize newly impounded streams. Generally, it is found in substrates of mud or sand, but can also be found in gravel.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Adults are essentially sessile. About the only voluntary movement they make is to burrow deeper into the substrate (potential for this good because of this mussels affinity for soft substrates). Some passive movement downstream may occur during high flows. Dispersal occurs while the glochidia are encysted on their host (probably a fish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Presumably fine particulate organic matter, primarily detritus, and/or zooplankton, and/or phytoplankton (Fuller, 1974). Larvae (glochidia) of freshwater mussels generally are parasitic on fish and there may be a specificity among some species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

Glochidial metamorphosis and natural infestations have been observed for bluegill, green sunfish, black crappie, rock bass, largemouth bass, bluntnose minnow, central stoneroller, common shiner, striped shiner, blackchin shiner, blacknose shiner, brook silverside, Iowa darter, Johnny darter, rainbow darter, and yellow perch.

In lab trials, glochidial metamorphosis was observed on banded killifish, golden topminnow, longnose gar, longear sunfish, pumpkinseed, creek chub, golden shiner, redfin shiner, blacknose dace, brook stickleback

Ecosystem Impact: parasite

Species Used as Host:

  • Arey, L. 1932. The formation and structure of the glochidial cyst. Biological Bulletin (Woods Hole), 62: 212-221.
  • Howells, R. 1997. New fish hosts for nine freshwater mussels (Bivalvia: Unionidae) in Texas. Texas Journal of Science, 49: 255-258.
  • Trdan, R., W. Hoeh. 1982. Eurytopic host use by two congeneric species of freshwater mussel (Pelecypoda: Unionidae: Anodonta). American Midland Naturalist, 108: 381-388.
  • Penn, G. 1939. A study of the life cycle of the freshwater mussel, Anodonta grandis, in New Orleans. Nautilus, 52: 99-101.
  • Tucker, M. 1928. Studies on the life cycles of two species of fresh-water mussels belonging to the genus Anodonta. Biological Bulletin (Woods Hole), 54: 117-127.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: It is common in all Illinois drainages (Cummings and Mayer, 1997; Schanzle and Cummings, 1991; Schanzle et al., 2004; Sietman et al., 2001; Tiemann et al., 2005). Indiana: lower E Fork White (Harmon, 1992), Tippecanoe (Cummings and Berlocher, 1990); Muscatatuck (Harmon, 1989); Eel, St. Mary's, St. Joseph, Maumee (Pryor, 2005); and all of Ohio (Watters, 1995; Lyons et al., 2007; Hoggarth et al. 2007; Watters et al., 2009). In West Virginia, it occured in the Upper Ohio/Kanawha (Zeto et al., 1987) and Mud River (Guyandotte drainage) (Schmidt and Zeto, 1986). It is in every Minnesota drainage (Sietman, 2003): Lake of the Woods, Lake Superior Red (Graf, 1997; Cvancara, 1970). In Texas, it is in all drainages (Howells et al., 1996) introduced in Clement Lake, El Paso Co. and lower Rio Grande (Johnson, 1999). It is common throughout Alabama (Mirarchi, 2004); Choctawhatchee (Blalock-Herod et al., 2005), Alabama (McGregor et al., 1999); Florida in the Escambia (Butler, 1989) and Bear Creek, AL/MS (McGregor and Garner, 2004); not Yellow, Blackwater, and Perdido (Williams et al., 2008). Once since 1990s from Conecuh-Escambia and Choctawhatchee (Pilarczyk et al., 2006). In the Coosa basin, Georgia, it is historical from the Coosa, Etowah, Oostanaula, Conasauga, and Coosawattee (Williams and Hughes, 1998). It is in South Dakota streams (Backlund, 2000); incl. Lakes Lewis and Clark, Oahe and Sharpe, James (Perkins and Backlund, 2003), Big Sioux (Skadsen and Perkins, 2000), Minnesota River basins (Shearer et al., 2005). In Montana, it is in the NE and SE (Milk, Missouri, Little Missouri, Yellowstone, Musselshell drainages) (Gangloff and Gustafson, 2000; Stagliano, 2010). In Vermont, it is only in Lake Champlain and tribs- Missisquoi, Lamoille, Otter, East, Hubbardton, Poultney, Winooski Rivers (Fichtel and Smith, 1995). In Wisconsin it is widespread and abundant (Mathiak, 1979). In North Carolina, it is in the French Broad River and introduced in Jordan Lake (Cape Fear basin) (Bogan, 2002). In Mississippi, it is in all drainages except Coastal (Jones et al., 2005); Strong River (Darden et al., 2002). In Louisiana, it is common and widespread (Vidrine, 1993). Arkansas: Poteau (Vaughn and Spooner, 2004), Ouachita (Posey et al., 1996), Cache (Christian, 1995; Christian et al., 2005), White (Gordon, 1982; Gordon et al., 1994), St. Francis (Ahlstedt and Jenkinson, 1991), lower Arkansas (Gordon, 1985). In Tennessee, it is in the upper Powell, Clinch, Elk, Harpeth, Duck, Obion, Hatchie; impounded Tennessee and Cumberland Rivers, and Reelfoot Lake (Parmalee and Bogan, 1998). It is in the ACF basin (AL/FL/GA) (Brim-Box and Williams, 2000). In Kentucky, it is nearly statewide (Cicerello and Schuster, 2003; Gordon, 1991). In Wyoming, it is in the Belle Fourche and Little Missouri drainages, Cooke Co. (Cvancara, 2005). In Colorado, it is stable on eastern plains but lentic (Cordeiro, 1999; Wu, 1989; Clark et al., 2003). Oklahoma: Chikaskia, Verdigris, Kiamichi, Poteau, Neosho, Glover, Little, Mountain Fork, Blue, Washita, Red Rivers; Lake Murray, Texoma, Big and Middle Caney rivers (Branson, 1983; Vaughn, 2000). In Kansas, it is statewide and common (Couch, 1997; Tiemann, 2006). It is in the Little Blue basin (Hoke, 2004); and common in the Big Blue system, SE Nebraska and NE Kansas (Hoke, 2005) and common in Platte (Freeman and Perkins, 1992) and Cherry Co. on Niobrara (Freeman and Perkins, 1997) Rivers, Nebraska. It is in the Clinton drainage, Michigan (Trdan and Hoeh, 1993; Strayer, 1980) to Kalamazoo River (Mulcrone and Mehlne, 2001) to upper peninsula (Goodrich and Van der Schalie, 1939) in Lakes Michigan, Huron, St. Clair (Badra and Goforth, 2003). In Canada, it is widespread and common from Alberta and Northwest Territories (N to Shell Lake, Inuvik) E through Manitoba (Assiniboine drainage- Watson, 2000; Pip, 2006) to Ontario (Metcalfe-Smith et al., 2003; Schueler and Karstad, 2007) and Quebec (Metcalfe-Smith and Cudmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: See Huebner et al. (1989) for population estimates in lakes in northwestern Ontario. In the ACF basin, it was recently collected from 54 of 324 sites (35 live, 52 shells) in Alabama, Florida, and Georgia in the mainstem and tributaries of the Apalachicola, Chipola, Chattahoochee, and Flint Rivers (Brim-Box and Williams, 2000). Martel et al. (2004) recorded it in Lac Philippe, Gatineau Park, SW Quebec. Smith and Crabtree (2010) found this species at 1 of 32 sites (0 with recruitment) along the entire length of Pennsylvania's French Creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A species that is apparently tolerant of a fairly wide range of habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. How the giant floater attracts its fish hosts is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Probably bradytictic (long-term brooder). This species has many glochidial hosts including Alosa chrysochloris (skipjack herring), Ambloplites rupestris (rock bass), Ameiurus natalis (yellow bullhead), Aplodinotus grunniens (freshwater drum), Campostoma anomalum (central stoneroller), Carpiodes carpio (river carpsucker), Carrasius auratus (goldfish), Catostomus commersoni (white sucker), Cichlasoma cyanoguttatum (Rio Grande cichlid), Culaea inconstans (brook stickleback), Cyprinus carpio (common carp), Dorosoma cepedianum (gizzard shad), Etheostoma caeruleum (rainbow darter), Etheostoma exile (Iowa darter), Etheostoma nigrum (Johnny darter), Fundulus chrysotus (golden topminnow), Fundulus diaphanus (banded killifish), Labidesthes sicculus (brook silverside), Lepisosteus osseus (longnose gar), Lepomis cyanellus (green sunfish), Lepomis gibbosus (pumpkinseed), Lepomis humilis (orangespotted sunfish), Lepomis macrochirus (bluegill), Lepomis megalotis (longear sunfish), Luxilus chrysocephalus (striped shiner), Luxilus cornutus (common shiner), Lythrurus umbratilis (redfin shiner), Margariscus margarita (pearl dace), Micropterus salmoides (largemouth bass), Morone chrysops (white bass), Neogobius melanostomus (round goby), Notemigonus chrysoleucas (golden shiner), Notropis heterodon (blackchin shiner), Notropis heterolepis (blacknose shiner), Perca flavescens (yellow perch), Pimephales notatus (bluntnose minnow), Poecilla reticulata (guppy), Pomoxis annularis (white crappie), Pomoxis nigromaculatus (black crappie), Rhinychthys atratulus (blacknose dace), Rutilus rutilus (roach), and Semotilus atromaculatus (creek chub) (Surber, 1913; Wilson, 1916; Lefevre and Curtis, 1910; Tucker, 1928; Arey, 1932; Clark and Berg, 1959; Trdan and Hoeh, 1982; Howells, 1997; Hankinson, 1908; Fuller, 1978; Penn, 1939; Read and Oliver, 1953; Jansen and Hanson, 1991; Jansen, 1991; Watters et al., 2005))

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

In the Huron River in Michigan, Pyganodon grandis was gravid from early August to the following mid-April. It probably spawns from May through July in Michigan.

Breeding interval: The giant floater breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably May through July.

Range gestation period: 10 (high) months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pyganodon grandis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Pyganodon grandis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATTTGTTATTGGCATTATGGTCTGGTCTTATTGGGTTGGCCTTAAGGCTTTTAATCCGAGCTGAGTTAGGGCAACCAGGAAGGTTACTCGGGGAT---GATCAGTTGTATAACGTAATTGTTACAGCTCATGCATTTATAATAATTTTTTTTCTAGTAATACCTATGATAATTGGAGGATTTGGTAATTGGCTTATTCCTTTAATAATTGGTGCTCCTGATATGGCTTTTCCTCGACTAAATAATCTAAGGTTTTGACTTCTTGTCCCAGCTTTGTTTTTGTTGTTGAGGTCTTCGTTGGTCGAAAGGGGTGTTGGTACTGGTTGGACAGTATATCCTCCTTTGTCTGGGAATATTGCTCATTCTGGGGCTTCGGTAGATTTGGCTATTTTTTCTTTACACCTTGCTGGAGCTTCGTCAATTTTGGGTGCTATTAACTTTATTTCCACTGCTGGGAATATACGTTCTCCTGGTTTGGTTGCTGAGCGAATTCCGTTATTTGTTTGGGCTGTTACAGTGACAGCTGTGTTACTAGTAGCTGCTTTACCAGTTTTGGCTGGTGCGATTACAATGTTGCTTACTGATCGTAATTTGAATACTTCATTTTTTGACCCTACAGGGGGTGGTGATCCTATTTTGTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is widespread and common in North America and can tolerate a much wider range of habitats than many other unionids.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: This species inhabits permanent ponds, lakes, and rivers of various sizes, usually on mud but also found on other substrates; 0.2 m water depth and beyond. It attains its greatest abundance and individual size in reservoirs, lakes and ponds having a mud bottom with little or no current but is tolerant of slow flowing pool area of rivers of all sizes (Parmalee and Bogan, 1998). It is more tolerant of low oxygen levels than other unionid species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Cummings, K. & Cordeiro, J.

Reviewer/s
Bohm, M., Collen, B. & Seddon, M.

Contributor/s
Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., Milligan, HT, De Silva, R., Herdson, R., Thorley, J., McMillan, K., Collins, A., Offord, S., Duncan, C. & Richman, N.

Justification
Pyganodon grandis has been assessed as Least Concern. This species has a wide distribution, a large, stable population with no major threats and is a generalist that can tolerate sedimentation and pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pyganodon grandis is fairly common throughout its range. However, it is considered Threatened in Vermont.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to increase of 25%

Comments: Some declines have occurred in Colorado streams, at the edge of its western range, but reservoir populations are widespread, though uncommon (Cordeiro, 1999; Clarke et al., 2003). This species is considered stable in the ACF basin (Brim Box and Williams, 2000).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species has a stable, common and abundant population that is showing no evidence of decline, most likely due to the fact that it can tolerate impoundment conditions (Parmalee and Bogan 1998, Cummings and Berlocher 1990, NatureServe 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: Is tolerant of low oxygen levels and conditions in some impounded areas. Gross water pollution would probably be fatal. This species is also tolerant of flow regime change and can survive sedimentation and pollution events.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no known major threats to this species. It has been found to be tolerant of sedimentation and pollution to a certain degree and thus these processes do not pose a significant threat to the species throughout its range (Parmalee and Bogan 1998, NatureServe 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: In the Cuyahoga Valley National Park (between Cleveland and Akron, Ohio), this species was recently found in the Cuyahoga River, Ohio and Erie Canal, and lakes and ponds within the park (Smith et al., 2002). This species occurs in Muddy Creek (French Creek drainage) in the Erie NWR in Crawford Co., Pennsylvania (Mohler et al., 2006). In the Cuyahoga Valley National Park (between Cleveland and Akron), it was abundant in the Cuyahoga River and Erie Canal (Smith et al., 2002). Specimens from the Black River (St. Clair drainage), Michigan, were relocated to the Detroit River in 1992 (Trdan and Hoeh, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species, however, in places its distribution coincides with protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Because it is so abundant it could be used for bait.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pyganodon grandis

Pyganodon grandis (giant floater) is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels. This species is fast-growing, large, and has a short lifespan.

This species is endemic to the United States.

Sources[edit]

Haag, W. R. (2012). North American Freshwater Mussels: Natural History, Ecology, and Conservation. Cambridge University Press. ISBN 978-0521199384


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hoeh (1990) split Anodonta cataracta cataracta and Anodonta cataracta fragilis into distinct species (elevating Pyganodon to genus level in the process). Also Hoeh and Burch (1989) separated Anodonta lacustris as a valid species from Anodonta grandis and Anodonta cataracta and Hoeh (1990) placed them in Pyganodon as Anodonta marginata sensu strictu, is considered a nomen dubium (see Hoeh and Burch, 1989). Recently, Zanatta et al. (2007) supported the monophyly of both Pyganodon and Utterbackia using mutation coding of allozyme data, but also resolved the Eurasian Anodonta cygnea to Pyganodon, Utterbackia, and North American Anodonta; indicating futher phylogenetic analysis of the Anodontinae is required including both North American and Eurasian species. There is some speculation that this species may hybridize with Pyganodon cataracta (Kat, 1985; 1986). It is undoubtedly a species complex that needs more study throughout its range (Park and Burch, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!