Overview

Comprehensive Description

Biology

Occurs primarily in estuaries and lagoons, but also found in lakes and rivers. Entire life cycle is completed in the estuary (Ref. 32693). Can tolerate salinities under 4 ppt and of up to 52.6 ppt (Ref. 32693). Breeds throughout the year with a peak in spring and early summer. Maturity may be attained within the first or second year and an age of up to 5 or 6 years is recorded. Feeds chiefly on zooplankton by filtering or selecting individual organisms from the water column (Ref. 7248). Utilized fresh or dried and salted (Ref. 12484).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

South-west to south-east African coastal systems. Ranging from Namibia to at least Maputo, Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Africa: Lake Piti, Mozambique along southern African coast to Saldanha Bay, possibly mouth of Orange River (but perhaps confused by presence of a second undescribed species). Reported occurrence in India (Ref. 32693) needs validation (Ref. 33664). Reports of the occurrence in Madagascan waters (Ref. 13333) are in error (Ref. 33664).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern Atlantic and southwestern Indian Ocean off southern Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 18; Analspines: 0; Analsoft rays: 16 - 27
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 4967)); max. reported age: 6 years (Ref. 7248)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

With 6 to 9 unkeeled pre-pelvic scutes, followed by an equally thin pelvic scute, all with slender ascending arms; no post-pelvic scutes. Snout pointed, lower jaw a little prominent, with a single row of fine teeth in each jaw; second supra-maxilla paddle-shaped. Gill rakers small but present on posterior face of third epibranchial (cf. absent in Ehirava fluviatilis).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Present in open and closed estuaries, lower reaches of some large rivers just above estuary heads and some permanent coastal, freshwater lakes.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; amphidromous; freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 17

Graphical representation

Depth range (m): 2 - 17
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs primarily in estuaries and lagoons, but also found in lakes and rivers. Entire life cycle is completed in the estuary (Ref. 32693). Can tolerate salinities under 4 ppt and of up to 52.6 ppt (Ref. 32693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

A semelparous species that grows to maturity and spawns in one year (Ref. 34361).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gilchristella aestuaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATATAGTATTTGGTGCCTGAGCAGGGATAGTGGGCACAGCCCTAAGCCTGCTAATTCGAGCAGAGCTTAGCCAACCCGGGGCTCTCCTAGGAGATGATCAAATCTATAATGTTATCGTTACTGCACATGCTTTCGTAATAATTTTCTTCATAGTAATACCTATTCTTATCGGGGGGTTCGGAAACTGACTGGTCCCGCTTATGATTGGAGCGCCTGATATGGCATTCCCCCGGATGAATAACATAAGCTTCTGACTTCTCCCCCCTTCATTCTTGTTACTCTTGGCCTCCTCAGGAGTTGAAGCCGGGGCCGGAACTGGATGAACAGTTTACCCCCCTCTTGCAGGAAACCTGGCCCACGCTGGTGCATCTGTAGACCTAACTATTTTCTCCCTCCACTTGGCCGGAATCTCCTCAATCCTAGGGGCTATCAACTTTATTACTACTATCATTAACATGAAGCCCCCTGCAATTTCACAATATCAAACACCCCTGTTTGTATGGTCTGTGCTAGTCACAGCCGTTCTTCTACTTTTATCCCTGCCTGTCTTAGCTGCAGGAATTACAATACTTCTCACAGACCGAAACCTTAACACAACATTCTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gilchristella aestuaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Bills, R.

Reviewer/s
Snoeks, J. (Freshwater Fish Red List Authority) & Darwall, W. (Freshwater Biodiversity Assessment Unit)

Contributor/s

Justification
Widely distributed around the southern African coastal river systems and estuaries. In many places it is abundant. No indication of major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
High salinities in estuarine systems have resulted in mass mortalities. Salinity increases are often due to over-extraction of water from upper catchments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
River health and water conservation programmes are needed to ensure healthy estuarine conditions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gilchristella aestuaria

Gilchristella aestuaria, the Gilchrist's round herring or estuarine round-herring,[2] is a member of the herring family Clupeidae that occurs off the coasts of Southern Africa. It is the only species in its genus, which was named for John Dow Fisher Gilchrist (1866–1926).[3]

Information[edit]

There are no indications of major threats to this species. It is considered to be of least concern for becoming an endangered species.[1]

Size[edit]

The average length of the G. aestuaria as an unsexed male is about ten centimeters.[4]

Habitat[edit]

The Gilchristella aestuaria can be found in a marine environment and in freshwater. The habitat is located in subtropical climates. This species is primarily found in estuaries, lagoons, lakes, and rivers.[4] It is considered an extremely important fish in estuaries of South Africa .[5] This small sardine-like fish lives in large shoals and provides an important link in the food chain as a food source to larger fish and water birds.[5] This fish does not survive in an aquarium, presumably dying from capture myopathy or stress.[5]

Distribution[edit]

The Gilchristella aestuaria is distributed throughout the following areas:

  • Africa
  • Lake Piti
  • Mozambique
  • Southern African coast
  • Saldanha Bay
  • Orange River[4]
  • Namibia
  • South Africa
  • Eastern Cape Province
  • KwaZulu-Natal
  • Northern Cape Province [1]

References[edit]

  1. ^ a b c "Gilchristella aestuaria". International Union for Conservation of Nature and Natural Resources. Retrieved 12 February 2013. 
  2. ^ "Gilchristella aestuaria Estuarine round-herring". Animal Diversity. Retrieved 12 February 2013. 
  3. ^ "John Dow Fisher Gilchrist". Neglected Science. 2011. Retrieved 18 January 2014. 
  4. ^ a b c "Gilchristella aestuaria". Fish Base. Retrieved 12 February 2013. 
  5. ^ a b c Paul Skelton (1993). A Complete Guide to the Freshwater Fishes of Southern Africa. Southern Book Publishers. p. 390. ISBN 1-86812-350-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!