Ecology

Habitat

Depth range based on 3298 specimens in 25 taxa.
Water temperature and chemistry ranges based on 2497 samples.

Environmental ranges
  Depth range (m): 0 - 4817
  Temperature range (°C): -1.916 - 27.668
  Nitrate (umol/L): 0.267 - 44.478
  Salinity (PPS): 30.510 - 38.824
  Oxygen (ml/l): 1.058 - 8.441
  Phosphate (umol/l): 0.038 - 3.178
  Silicate (umol/l): 1.010 - 152.463

Graphical representation

Depth range (m): 0 - 4817

Temperature range (°C): -1.916 - 27.668

Nitrate (umol/L): 0.267 - 44.478

Salinity (PPS): 30.510 - 38.824

Oxygen (ml/l): 1.058 - 8.441

Phosphate (umol/l): 0.038 - 3.178

Silicate (umol/l): 1.010 - 152.463
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:200Public Records:21
Specimens with Sequences:112Public Species:3
Specimens with Barcodes:111Public BINs:4
Species:24         
Species With Barcodes:19         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelina sp. E JA

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelina sp. F JA

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ophelina acuminata CMC02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNTACTTCATTTTCGGAGCATGAGGAGGCCTTCTTGGCACCTCCATAAGTCTCCTTATTCGAGCTGAGCTTGGACAACCTGGATCCCTTCTAGGAAGGGACCAGCTCTATAACACTATTGTTACCGCTCACGCCTTTCTAATAATTTTCTTTCTTGTTATACCAGTATTTATTGGAGGCTTTGGAAACTGACTCATCCCCCTAATACTAGGGGCCCCAGATATGGCATTTCCTCGGCTAAACAATATAAGATTCTGACTTCTCCCCCCGTCTCTCATTCTTCTAGTTTCTTCCGCAGCTGTAGAAAAAGGAGTCGGAACAGGATGAACCGTCTACCCCCCTCTCTCTAGAAACCTAGCCCACGCTGGTCCCTCTGTAGATCTAGCAATTTTCTCTCTACACCTAGCTGGAATTTCATCAATTCTAGGCTCTCTAAACTTCATCACTACTGTAATCAATATACGATGAAAAGGACTTCGTCTTGAACGTATCCCTCTCTTTGTATGAGCAGCTGTAATTACAACTGTTCTTCTTCTCCTATCTCTACCAGTACTCGCCGGTGCTATTACTATACTCCTTACTGACCGAAATCTAAATACTGCATTCTTTGACCCTGCAGGCGGTGGAGACCCTGTTCTTTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophelina acuminata CMC02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Ophelina

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!