Molecular Biology and Genetics

Molecular Biology

Barcode data: Trialeurodes vaporariorum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAAAACCTGGATATTTTCAACTAACCACAAAGATATTGGATTTCTGTATTTTTTATTTGGTATTTGAAGGGGCTTAATGGGCGTTTCTCTTAGGCTTTTGATTCGATTAGAGTTGAGTAATGTGGGGCTTTACCTTAATGATGGTCAAGTTTATAATGTTCTGGTAACTTCTCATGCATTTATTATAATTTTTTTTATGACTATGCCTCTTGTTATTGGTGGGTTCGGGAACTGGCTGGTTCCTCTTATGGTTGGGGCTCCTGATATGGCGTTTCCTCGAATAAATAATCTTAGATTTTGGCTGTTGGTTCCTTCTTTGTTTTTTATGCTTGTTAGACTTTTGATTGATAGGGGAAGCGGCACGGGTTGAACTGTTTATCCCCCCCTATCTATAAGGCTGTCACATAGGGGGAATTCTGTCGATTTTTCTATTATTTCTTTGCACGTTGCTGGAATTTCTTCTATTTTGGGATCACTTAATTTTATCGTGACTATTGTAAACATGCGGGCGTTGGGCATAAAAATGGAGTTTTTATCTTTGTTTGTCTGATCTGTGTTTATTACTGTTTTCTTGCTTTTAATTTCTCTTCCTGTGTTGGCAGGGGCAATTACTATACTTTTACTGGATCGTAATTTTAATAGTTCATTTTATGACCCTAGTGGTGGGGGGGATCCAATTTTGTATCAACACTTATTTTGATTTTTTGGTCATCCTGAGGTGTATGTTCTTATTTTGCCTGGTTTTGGCATTATTTCTCATCTTATTAGTGCTGAGGCGGGGAAAATTGAAGTCTTTGGAAGCCTCGGTATAATTTACGCTATAGTAACTATCGGTGTGTTGGGGTTTATTGTTTGGGGACATCATATATTTACTGTAGGAATGGATGTGGACACTCGCGCTTACTTTACTTCTGCTACTATAATTATTGCTGTTCCTACTGGAATTAAAATTTTCAGTTGACTTGCGACCTTGGGGGGCGCGCGTCTGTCATTTAATCCCCTTACTTCTTGGTTTACTGGATTTTTATTTCTTTTTACTTTAGGGGGTCTCACAGGGGTGATTTTGGGTAATTCTTCTGTGGATGTTTGTCTTCATGATACTTACTTTGTTGTTGCTCATTTTCACTATGTTTTATCTATGGGGATTATTTTCGCTATTATAGGGGGTCTTGTGTTTTGATTTCCATTGGTAGTAGGAGTTAGTTTAAATTTTAACCTTCTTCTTTCCCAGTTTTGTTTAATGTTTTTAGGTGTTAATTTAACATTTTTTCCTCAGCACTTTTTGGGTTTAAGGGGGATGCCTCGGCGTTATGTTGATTATGCAGACTGTTACATTGTTTGAAACAAGGTTTCTTCTATTGGGAGACTTGTTAGTTTAGTTTCTATTTTAATATTTTTATATATTATTATGGAATCTTTCTTGGTTCTTCGTGTTTTAAGTTGTAAATTATTTATGGTGGGTTCACTAGAGTGGGTGCTAAATAAGCCATCTCTTAGTCACTCGTTTAAAGAGTTGTGTTTAATCAATTTTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trialeurodes vaporariorum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Greenhouse whitefly

Trialeurodes vaporariorum, commonly known as the glasshouse or greenhouse whitefly inhabits the world's temperate regions. It is a primary insect pest of many fruit, vegetable and ornamental crops, frequently being found in glasshouses and other protected horticultural environments. Adults are 1–2 mm in length, with yellowish bodies and four wax-coated wings held near parallel to the leaf surface.

Contents

Life cycle

Females are capable of mating less than 24 hours after emergence and most frequently lay their eggs on the undersides of leaves. Eggs are pale yellow in colour, before turning grey prior to hatching. Newly hatched larvae, often known as crawlers, are the only mobile immature life-stage. During the first and second larval instars, the appearance is that of a pale yellow/translucent, flat scale which can be difficult to distinguish with the naked eye. During the fourth and final immature life-stage referred to as the "pupa", compound eyes and other body tissues become visible as the larvae thicken and rise from the leaf-surface. However, this stage cannot be defined as a true pupa stage as hemipterans do not exude this stage of development.

Plant damage

All life-stages apart from eggs and "pupae" cause crop damage through direct feeding, inserting their stylet into leaf veins and extracting nourishment from the phloem sap. As a by-product of feeding, honeydew is excreted and that alone can be a second, major source of damage. The third and potentially most harmful characteristic is the ability of adults to transmit several plant viruses. The crop hosts principally affected are vegetables such as cucurbits, potatoes and tomatoes, although a range of other crop and non-crop plants including weed species are susceptible, and can therefore harbour the infection.

Control

Effective control has been provided for many years through the release of beneficial insects, such as the aphelinid parasitoid, Encarsia formosa (Gahan). If required, integrated pest management strategies can incorporate applications of selective chemical insecticides or biopesticides such as Lecanicillium muscarium that complement these natural enemies. For the majority of outdoor crops chemicals are still the most widely used method of control.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!