Overview

Distribution

Range Description

This species is widespread throughout the Indo-Pacific between latitudes 30°N and 30°S (Hamel et al. 2001), from South Africa to the Red Sea, India, China and Japan to Australia, and to Micronesia in the northeast and Tonga in the southeast. In Madagascar, this species is observed in the west coast from the south of Toliara to Nosy-be (Rasolofonirina pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Colour in life: brown with small white spots dorsally, or a few pale blotches, sides becoming pale and sole milky white. Often with commensal portunid Lissocarcinus orbicularis varying from brown carapuce to large brown reticulation on white back-ground, usually 2-4 individuals; also usually with commensal polynoid Gastrolepidia clavigera SCHMARDA (Humphreys, 1981). Also distributed in Celebes (Selenka, 1867); Philippines and Fiji (Pearson, 1910), India (Sastry, 1996); SE Arabia, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan and South Pacific Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995). General distribution: tropical, Indo-west Pacific Ocean, depth range 0-10 m. (Rowe & Gates, 1995); widespread in the tropical Indo-Pacific (Conand, 1998). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
  • Tortonese, E. (1980). Researches on the coast of Somalia. Littoral Echinodermata. Monitore zoologico italiano NS Supplemento XIII 5: 99-139.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species is distributed mainly in low energy environments behind fringing reefs or within protected bays and shores. Individuals prefer ordinary coastal areas to coral reefs, particularly intertidal seagrass beds close to mangroves, however they are also found along inner reef flats and lagoons. This species is attracted to muddy sand or mud habitats (Rasolofonirina pers. comm. 2010, Skewes et al. 2004). Juveniles of this species settle in shallow seagrass beds and some may make it to deeper waters (Mercier et al. 1999). This species has been found to preferentially settle on seagrass such as Thallassia hemprichi (Hamel et al. 2001). Recent studies on released juveniles have shown that mangrove/seagrass areas were the most suitable habitat for settling juveniles, due mainly to low predation rates (Dance et al. 2003, Skewes et al. 2004). This species is also known to burrow, possibly leading to biased transect data.

In the Western Central Pacific, this species can be found in inner reef flats of fringing reefs and lagoon islets between 0 and 15 m (Kinch et al. 2008). In Viet Nam, it is found in sandy estuaries or lagoons between 2 and 25 m (Choo 2008). In the Africa and Indian Ocean region, this species can be found in the back reef over muddy sand between 0 and 5 m, in the vicinity of mangroves; both adults and juveniles burrow in the sand (Conand 2008). In Madagascar, it can be found in the inner slope and seagrass beds, with highest densities in the latter (Conand 2008). This species has narrow habitat preferences that restrict it's range within the Torres Straight and the surrounding areas of Australia (Skewes et al. 2004).

In the Western Central Pacific, reproductive biology studies have been conducted by several authors, yielding the following information on reproductive periods: Great Barrier Reef (Australia) between November and January, Great Barrier Reef (Australia) November and December, Northern Territory (Australia) between December and February; New Caledonia December to January and August to September; PNG in November and December; Solomon Islands from September to December (Kinch et al. 2008). In India, only a careful microscopic revision of the gametes allows identification of a specimen as male or female (James 2004). In Asian countries near the Equator, this species spawns throughout the year. However, in Indonesia, it had two peak spawning periods, whilst in the Philippines, the main spawning event is from May to June and October to November (Choo 2008). In Australia, this species seems to follow a pattern of spawning in warmer months, but also undergoes a smaller, secondary peak of spawning later in the year (Skewes et al. 2004).

Larvae of this species are planctonic, small juveniles under 10 mm in length that are epibiontic (live on seagrasses) and juveniles and adults are endobiontic. This species grows relatively fast when young, reaching size at first maturity at ca. 180 g in a year (Conand 1989, Purcell 2010). Shelley (1985) estimated that it grows 14 g/month. In the Philippines, size at first maturity is 120 g (Gamboa pers. comm. 2010). In captivity, this species has reached settling stage after 13-16 days as planktonic larvae (Skewes et al. 2004). This species is reported to mature and to grow to 15 cm in one to two years (Skewes et al. 2000). This species recruits well under proper conditions.

In general, generation length is unknown for these species. Body size is not a good indicator of age or longevity. There is some indication, however, that many echinoderms do not go through senescence, but simply regenerate. Therefore generation length cannot be estimated, but is assumed to be greater than several decades (20-40 years) in a natural, undisturbed environment.


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 25 specimens in 2 taxa.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.5 - 59.2
  Temperature range (°C): 24.872 - 28.764
  Nitrate (umol/L): 0.156 - 1.129
  Salinity (PPS): 33.691 - 35.361
  Oxygen (ml/l): 4.450 - 4.685
  Phosphate (umol/l): 0.055 - 0.201
  Silicate (umol/l): 0.777 - 3.887

Graphical representation

Depth range (m): 0.5 - 59.2

Temperature range (°C): 24.872 - 28.764

Nitrate (umol/L): 0.156 - 1.129

Salinity (PPS): 33.691 - 35.361

Oxygen (ml/l): 4.450 - 4.685

Phosphate (umol/l): 0.055 - 0.201

Silicate (umol/l): 0.777 - 3.887
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria scabra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AAATGACTCATTCCCTTAATG---ATAGGAGCCCCAGATATGGCTTTTCCTCGGATGAAAAAAATGAGTTTCTGATTAGTTCCTCCTTCATTTATACTTCTCCTAGCTTCAGCAGGTATAGAAAGAGGAGCGGGTACAGGATGGACTATATACCCACCACTATCCAGAAAAATTGCCCATGCCGGAGGATCTGTTGACCTA---GCCATTTTCTCACTACACTTAGCCGGAGCCTCTTCTATTCTAGCTTCCATAAACTTCATAACCACAATCATAAACATGCGAACTCCAGGGATAACATTCGACCGACTTCCCTTATTTGTATGATCAGTCTTCATCACAGCCTTTCTTCTCTTACTAAGACTACCAGTTCTAGCAGGA---GCCATAACAATGCTACTAACAGACCGAAACATAAAAACAACATTTTTTGACCCTGCAGGAGGAGGAGACCCGATCTTATTTCAACATTTGTTCTGATTTTTTGGCCATCCAGAAGTCTACATCCTAATTCTTCCAGGATTCGGAATGATATCACATGTAATAGCCCACTACAGAGGTAAGCAA---GAACCATTCGGATACCTAGGAATGGTCTATGCGATGGTAGCCATAGGAATCCTAGGATTTCTAGTCTGAGCCCACCATATGTTCACAGTAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria scabra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd

Version
3.1

Year Assessed
2013

Assessor/s
Hamel, J.-F., Mercier, A., Conand, C., Purcell, S., Toral-Granda, T.-G. & Gamboa, R.

Reviewer/s
Polidoro, B., Carpenter, K.E., Knapp, L. & Harwell, H.

Contributor/s

Justification
This species is commercially exploited throughout its range for its high value as beche-de-mer to supply the Asian consumers around the world. Based on a number of quantitative and qualitative studies, populations are estimated to have declined by more than 90% in at least 50% of its range, and are considered overexploited in at least 30% of its range, although exact declines are difficult to estimate. The status of populations in China are not known, and populations near mainland Australia are targeted but not considered to be overexploited. Declines and overexploitation have occurred primarily since the 1960s, and although generation length is not known, echinoderms are not considered to go through senescence and therefore one generation length may be greater than several decades. As this species is estimated to have experienced at least a 50% decline over the past 30-50 years, it is therefore listed as Endangered. If fishing pressure was significantly decreased, this species may recover relatively quickly due to its reproductive capacity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Genetic studies on this species show distinct populations within Australia (the Northern Territory, the Torres Strait, the Solomon Islands, the Great Barrier Reef), the Solomon Islands, and New Caledonia with little geneflow (Kinch et al. 2008). Genetic studies involving this species have showed a very restricted gene flow indicating a limited recruitment from within regions (Uthicke and Benzie 2001, Skewes et al. 2004).

This species has been significantly depleted in at least 50% of its range (e.g. in East Africa, Madagascar, India, Viet Nam, Papua New Guinea, Solomon Islands) It is considered overexploited in at least another 25% of its range (e.g. Philippines and Indonesia), and the status of populations that have been heavily targeted in China are not known (Chen 2004, Li 2004). In New Caledonia, India and Malaysia catches have been depleted (Hamel et al. 2001), In the Torres Strait, the fishery for this species was closed in the mid 1990s, and the current biomass today is still estimated at less than 8 percent of the virgin biomass (Skewes et al. 2000). This species may also be overexploited in Vanuatu as the fishery has been closed since 2008. In Australia, this species is targeted in the Northern Territory, but is not considered to be overexploited, except possibly in the Torres Strait.

Depletion refers to commercially unviable, and estimated to represent an approximately 90% loss or greater over the past 25-50 years (since the 1960s). In areas where it is considered overexploited, populations are difficult to estimate based on regional and local fishing effort, but harvests have declined and based on traditional fisheries definitions, overexploited is estimated to be 30% above maximum sustainable yield. This species has been reported to be extirpated from a few locations in recent years (in Egypt see Hasan 2005; parts of Indonesia, Thailand, Viet Nam and Malaysia see Choo 2008; Papua New Guinea Milne Bay see Skewes et al. 2002; and some parts of Solomon Islands see Friedman et al. 2010).

Regional and Country Specific Information:

In the Solomon Islands, this species is considered rare. In Samoa, the little information available on sea cucumber densities showed the absence of this species. In Palau, recorded densities of this species in 2003 were 40 ind/ha. In Vanuatu, there were 43 ind/ha in 1987, however recent surveys show lower densities in certain sites. In Fiji, there were 625 ind/ha in 1993, while in 2003 there were only 160 ind/hain areas close to Suva (Kinch et al. 2008). Also in Fiji, catches for this species peaked at 700 t in 1988, and stocks are now considered depleted (Bruckner et al. 2003).

In New Caledonia, information suggests some overharvesting. In New Caledonia, populations of a few commercial species appear depleted, namely Holothuria fuscogilva, Holothuria lessoni and Actinopyga lecanora. Several other species are perhaps not critically low but are relatively sparse, namely Actinpyga mauritiana, A. miliaris and this species (Purcell et al. 2009). Furthermore, although few of this species are found in field surveys, they are still one of the most common species collected by fishers (Purcell et al. 2009). In New Caledonia, exports were over 125 t in 1990 and 1991 with declines to less than 81 t/yr from 1992 to 1994 (A. miliaris harvest ~75% of exports; this species harvest ~ 25% of exports). Exports continued to decline from 79.8 t in 1994 to 39.1 t in 1998 (Bruckner et al. 2003).

Recent information from Papua New Guinea indicates that this species has been overexploited. In New Ireland Province, the fishery for this species targets all sizes. In the Western Province of Papua New Guinea, this species formed 100% of the sea cucumber catch in 1990 and 1991, and dropped only because of depleted stocks (Lokani pers. obs.). Catches in Papua New Guinea dropped from 192,647 kg/year in 1991 to 39,302 kg/year in 1993.

In Torres Strait (Australia), 1996 surveys showed suppressed stocks of this species and only small individuals, and a further survey in 1998 confirmed these results. This species is considered over-exploited in Torres Straight, fully exploited in the Northern Territories, and unexploited in Queensland waters (Skewes et al. 2004). In Torres Strait, 1000 t of this species were harvested in 1995, and populations collapsed and the fishery for this species stopped (Bruckner et al. 2003). Other surveys done in 2000, 2002 and 2004 have shown only a very slow recovery of this species (Kinch et al. 2008).

Many tropical countries in the Indo-Pacific are targeting sea cucumbers with this species being the main overfished species (Choo 2008). In Indonesia (Sulawesi), this species is considered overfished and in other locations it is a rare species. In Malaysia, it is now rare and fishing pressure is focusing on other lower value species. In Thailand, its population has also become depleted. In Viet Nam, this species is fast approaching local extinction. In Philippines, monthly average landing of this species have been about 20 kg, well below the 109 kg average in 2002 (Choo 2008).

In India, Holothuria scabra, H. spinifera and Bohadschia marmorata have been collected over the last 1000 years. Fishermen began collecting other species in 1990 in response to high export value and population declines. Actinpyga echinites and A. miliaris populations were overexploited in some areas as early as 2 years later (Bruckner et al. 2003). Particularly in the Gulf of Manner and Pal Bay, CPUE and size of specimens has dramatically declined (Bruckner et al. 2003).

In Seychelles, it used to be collected in large numbers, but landings have decreased to very low levels. It is considered overexploited (Aumeeruddy and Conand 2008). In Tanzania, this species used to dominate the catches (Mgaya and Mmbaga 2007). In Egypt, it is almost completely lost (Lawrence et al. 2004).

In Madagascar, declining exports, quality and size of sea cucumbers, including this species, indicate that resources are overexploited (1998) (Bruckner et al. 2003). In Mozambique, high fluctuation in exports of this species, Holothuria nobilis, H. fuscogilva, H. atra, Actinpyga echinites and A. mauritiana may be due to irregular reporting or to overexploitation. Catch here was reported at 500 t in 1990, 700 t in 1993, 6 t in 1995, and 54 t in 1996. In Inhambane Province, holothurian fisheries are closed until stocks rebuild (Bruckner et al. 2003). Kalaeb et al. (2008) used transect data to calculate a population density of 7.5 individuals/ha of this species in Eritrea. In East Africa, fisheries for this species may now have trouble finding brood stocks (Conand pers. comm. 2010).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Commercial harvest is of high concern for this highly valued species (Toral-Granda 2006, 2007). This species is one of the most valuable species of holothurian and it is intensively exploited in many tropical countries for trade in the Asian markets (Rasolofonirina pers. comm. 2010). Despite being a high value species, this species showed an increase in catches after the decline in catch of Actinopyga miliaris as seen in Fiji (Kinch et al. 2008). This species has been heavily exploited in many parts of its range, and is also a bycatch of prawn nets in Madagascar (Toral-Granda 2007). Although few individuals are found in field surveys, they are still one of the most targeted species by fishers (Purcell et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

For stocks in Papua New Guinea, Kinch et al. (2008) note “Arguably, the declines in abundances of Holothuria scabra and H. whitmaei could qualify them for CITES listing”. At the CITES sea cucumber workshop in Malaysia in 2004, this species was identified as a species of highest concern due to its overexploitation (Toral-Granda 2007).

This species is regulated with a minimum size of 22 cm TL live and 10 cm TL dry in Papua New Guinea, 20 cm TL live and 10 cm TL in New Caledonia, 18 cm TL in Torres Strait, 17 cm TL in Moreton Bay, and 16 cm TL in Great Barrier Reef, Northern Territory and Western Australia (Australia) (Kinch et al. 2008). The Moreton Bay fishery (Australia) for this species is managed through permits as a developmental fishery. In Australia, a ban was put in place between 1996 and 2000, but no significant recovery was observed (Purcell 2010). In the Solomon Islands, release of cultured juveniles is sometimes used for restoring and enhancing natural stocks of this species (Battaglene 1999). In the Philippines the exporters observe a size limit 6.35 cm (dry length). However, bans are often not permanent. This species has been banned in Fiji, India, and Papua New Guinea, and the fishery has been closed in Vanuatu since 2008. Sea cucumber collection has been banned in the Andaman and Nicobar Islands (Bruckner et al. 2003). In Inhambane Province, holothurian fisheries have been closed until stocks rebuild (Bruckner et al. 2003). The effectiveness of the ban on this species' population is yet to be determined.

The fishery is not regulated in Thailand (Bruckner et al. 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Holothuria scabra

Holothuria scabra, or the sandfish, is a species of sea cucumber in the family Holothuriidae. It was placed in the subgenus Metriatyla by Rowe in 1969 and is the type species of the subgenus.[2] Sandfish are harvested and processed into "beche-de-mer" and eaten in China and other Pacific coastal communities.

Sea cucumbers are marine invertebrates and are closely related to sea urchins and starfish. All these groups tend to have radial symmetry and have a water vascular system that operates by hydrostatic pressure, enabling them to move around by use of many suckers known as tube feet. Sea cucumbers are usually leathery, gherkin-shaped animals with a cluster of feeding tentacles at one end surrounding the mouth.

Contents

Description

The sandfish is greyish-black on the upper side with dark-coloured wrinkles but paler on the underside. It grows up to four centimetres long, is broader than it is high and has a pliable skin. It is covered by calcareous spicules in the form of tablets and buttons.[3]

Distribution

This species is found in shallow water on soft sediments throughout the Indo-Pacific region.

Uses

The sandfish has been eaten by man for over 1000 years. About twenty other species of sea cucumber are also consumed but the sandfish is the species most often used. In the 1990s it was being sold dried as beche-de-mer for up to US$100 per kilogram.[4] Harvesting sandfish from the sea is known as trepanging in Indonesia. In many areas the fisheries have declined over the years because of over fishing, so ranching, aquaculture and hatchery rearing are being attempted.[4]

Hatchery rearing

Sandfish hatchery at Alaminos, Pangasinan
The Philippine "Balatan", or sea cucumber breeding/harvesting

Sandfish stocks are being increased in some areas by being bred in tanks at hatcheries. Spawning is induced by temperature shock and the fertilised eggs incubated for a day. The auricularian larvae that hatch from the eggs are fed on microalgae for nine days after which time they develop into doliolarian larvae. These are fed on diatoms and after five days settle as pentactular larvae onto diatom-coated plates. Juveniles are grown on in tanks and may reach one to two centimetres in three months. They are then moved to larger ponds for a few months before being released into suitable habitats for ranching or restocking.[5][6]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!