Overview

Distribution

Aldabra, Eastern Africa & Madagascar, Kenya, Kenyan Exclusive Economic Zone, Madagascar, Mascarene Basin, Mauritius, Mozambique, Red Sea, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Description

Colour in life: brown with small white spots dorsally, or a few pale blotches, sides becoming pale and sole milky white. Often with commensal portunid Lissocarcinus orbicularis varying from brown carapuce to large brown reticulation on white back-ground, usually 2-4 individuals; also usually with commensal polynoid Gastrolepidia clavigera SCHMARDA (Humphreys, 1981). Also distributed in Celebes (Selenka, 1867); Philippines and Fiji (Pearson, 1910), India (Sastry, 1996); SE Arabia, Maldive area, Ceylon, Bay of Bengal, East Indies, north Australia, Philippine, China, south Japan and South Pacific Is. (Clark & Rowe, 1971); Australia (Rowe & Gates, 1995). General distribution: tropical, Indo-west Pacific Ocean, depth range 0-10 m. (Rowe & Gates, 1995); widespread in the tropical Indo-Pacific (Conand, 1998). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 25 specimens in 2 taxa.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.5 - 59.2
  Temperature range (°C): 24.872 - 28.764
  Nitrate (umol/L): 0.156 - 1.129
  Salinity (PPS): 33.691 - 35.361
  Oxygen (ml/l): 4.450 - 4.685
  Phosphate (umol/l): 0.055 - 0.201
  Silicate (umol/l): 0.777 - 3.887

Graphical representation

Depth range (m): 0.5 - 59.2

Temperature range (°C): 24.872 - 28.764

Nitrate (umol/L): 0.156 - 1.129

Salinity (PPS): 33.691 - 35.361

Oxygen (ml/l): 4.450 - 4.685

Phosphate (umol/l): 0.055 - 0.201

Silicate (umol/l): 0.777 - 3.887
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria scabra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AAATGACTCATTCCCTTAATG---ATAGGAGCCCCAGATATGGCTTTTCCTCGGATGAAAAAAATGAGTTTCTGATTAGTTCCTCCTTCATTTATACTTCTCCTAGCTTCAGCAGGTATAGAAAGAGGAGCGGGTACAGGATGGACTATATACCCACCACTATCCAGAAAAATTGCCCATGCCGGAGGATCTGTTGACCTA---GCCATTTTCTCACTACACTTAGCCGGAGCCTCTTCTATTCTAGCTTCCATAAACTTCATAACCACAATCATAAACATGCGAACTCCAGGGATAACATTCGACCGACTTCCCTTATTTGTATGATCAGTCTTCATCACAGCCTTTCTTCTCTTACTAAGACTACCAGTTCTAGCAGGA---GCCATAACAATGCTACTAACAGACCGAAACATAAAAACAACATTTTTTGACCCTGCAGGAGGAGGAGACCCGATCTTATTTCAACATTTGTTCTGATTTTTTGGCCATCCAGAAGTCTACATCCTAATTCTTCCAGGATTCGGAATGATATCACATGTAATAGCCCACTACAGAGGTAAGCAA---GAACCATTCGGATACCTAGGAATGGTCTATGCGATGGTAGCCATAGGAATCCTAGGATTTCTAGTCTGAGCCCACCATATGTTCACAGTAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria scabra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Holothuria scabra

Holothuria scabra, or the sandfish, is a species of sea cucumber in the family Holothuriidae. It was placed in the subgenus Metriatyla by Rowe in 1969 and is the type species of the subgenus.[2] Sandfish are harvested and processed into "beche-de-mer" and eaten in China and other Pacific coastal communities.

Sea cucumbers are marine invertebrates and are closely related to sea urchins and starfish. All these groups tend to have radial symmetry and have a water vascular system that operates by hydrostatic pressure, enabling them to move around by use of many suckers known as tube feet. Sea cucumbers are usually leathery, gherkin-shaped animals with a cluster of feeding tentacles at one end surrounding the mouth.

Contents

Description

The sandfish is greyish-black on the upper side with dark-coloured wrinkles but paler on the underside. It grows up to four centimetres long, is broader than it is high and has a pliable skin. It is covered by calcareous spicules in the form of tablets and buttons.[3]

Distribution

This species is found in shallow water on soft sediments throughout the Indo-Pacific region.

Uses

The sandfish has been eaten by man for over 1000 years. About twenty other species of sea cucumber are also consumed but the sandfish is the species most often used. In the 1990s it was being sold dried as beche-de-mer for up to US$100 per kilogram.[4] Harvesting sandfish from the sea is known as trepanging in Indonesia. In many areas the fisheries have declined over the years because of over fishing, so ranching, aquaculture and hatchery rearing are being attempted.[4]

Hatchery rearing

Sandfish hatchery at Alaminos, Pangasinan
The Philippine "Balatan", or sea cucumber breeding/harvesting

Sandfish stocks are being increased in some areas by being bred in tanks at hatcheries. Spawning is induced by temperature shock and the fertilised eggs incubated for a day. The auricularian larvae that hatch from the eggs are fed on microalgae for nine days after which time they develop into doliolarian larvae. These are fed on diatoms and after five days settle as pentactular larvae onto diatom-coated plates. Juveniles are grown on in tanks and may reach one to two centimetres in three months. They are then moved to larger ponds for a few months before being released into suitable habitats for ranching or restocking.[5][6]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!