Overview

Distribution

In the tropical Indian Ocean known only from Madagascar; in the tropical Pacific, in the west from Australia and Sulawesi eastwards to Marianna Islands, Palau, and New Caledonia; tropical, Indo-west Pacific, depth range 3-12 m., also in Australia (Rowe & Gates, 1995); in East Indies (Clark & Rowe, 1971). Also distributed in Celebes (Selenka, 1867). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
  • Cherbonnier, G. (1988). Echinodermes: Holothurides. Faune de Madagascar 70: 1-292.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widespread in the Indian and tropical Pacific from East Africa to Australia and Sulawesi eastwards to Mariana Islands, Palau and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In the Western Central Pacific, this species prefers reef slopes, coral rubble and shallow seagrass beds between 0 and 25m (Kinch et al. 2008). In Africa and Indian Ocean region, it prefers lagoons and seagrass beds over sandy bottoms between 0 and 20m (Conand 2008). In the Comores, it inhabits shallow waters between 3 and 20m over sandy bottoms or in seagrass meadows.

Sexual reproduction takes place during the warm season. This is a species with low potential fecundity and late sexual maturity (Conand 1998).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 6 - 30
  Temperature range (°C): 26.525 - 28.432
  Nitrate (umol/L): 0.084 - 0.923
  Salinity (PPS): 34.519 - 35.095
  Oxygen (ml/l): 4.501 - 4.685
  Phosphate (umol/l): 0.092 - 0.122
  Silicate (umol/l): 0.869 - 1.110

Graphical representation

Depth range (m): 6 - 30

Temperature range (°C): 26.525 - 28.432

Nitrate (umol/L): 0.084 - 0.923

Salinity (PPS): 34.519 - 35.095

Oxygen (ml/l): 4.501 - 4.685

Phosphate (umol/l): 0.092 - 0.122

Silicate (umol/l): 0.869 - 1.110
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria fuscopunctata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATGATTAGGAGGATTTGGCAAATGGCTCATTCCCCTGATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTCCCCCTTCATTCATTCTTCTCCTAGCCTCAGCAGGCGTAGAAAGAGGAGCAGGCACAGGATGAACCATATACCCACCATTATCCAGAAACATTGCCCATGCTGGAGGGTCTGTTGACTTAGCTATTTTCTCTCTACACTTAGCCGGAGCCTCATCCATTCTAGCTTCTATAAACTTTATTACCACAATTATAAACATGCGGACCCCAGGAATAACATTCGACCGTCTTCCTTTATTCGTATGATCAGTTTTCATCACAGCCTTCCTTCTCCTACTTAGGCTACCAGTTCTAGCAGGAGCCATAACAATGCTGCTAACAGACCGGAACATAAAAACAACATTTTTCGACCCCGCAGGAGGAGGAGACCCAATCCTATTCCAACATCTATTCTGATTCTTTGGCCATCCAGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATATCACATGTAATAGCTCACTACAGAGGCAAGCAAGAGCCCTTTGGATATCTCGGAATGGTTTACGCAATGGTAGCCATAGGAATCCTAGGATTCCTAGTCTGAGCCCATCATATGTTCACAGTAGGAATGGACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria fuscopunctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Conand, C., Purcell, S. & Gamboa, R.

Reviewer/s
Polidoro, B., Carpenter, K.E., Knapp, L. & Harwell, H.

Contributor/s

Justification
This species is widespread in the Indian and tropical Pacific Oceans. It occurs in low densities and has low fecundity. It is increasingly being harvested in some parts of its range (particularly in the Philippines, Indonesia, and the south Pacific). Currently, there is no indication of widespread population decline. It is listed as Least Concern. However this species should be carefully monitored, especially if local and regional fishing pressure increases and as other stocks decrease.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

This species is common in some parts of its range, but is found at low densities in the Philippines.

In FSM, surveys showed that this species had smaller populations, whilst in Pohnpei it was in relatively high densities. In the Marshall Islands, it was also scarce, and in Tuvalu there were commercial densities (Kinch et al. 2008).

Population densities are usually around 0.005 individuals per square meter (Conand 1998).

In New Caledonia, Purcell et al. (2009) found this species to be very abundant at some sites near Nouméa and some sites further south, where 1,000 to 13,000 could be found per square kilometer of reef.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Commercial harvest is a potential threat to this species as harvest increases. Commercial value is currently low to medium. This species doesn't have a very good taste, and a yellow dye is released when captured.

Although not one of the most important species (low to medium commercial value) for fishery purposes, it can be expected that this species may become more popular after the depletion or reduction of other species of higher commercial importance and value.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

In PNG, this species is managed by a live size of 45cm TL and 15cm TL dry size, and in Torres Strait has a size limit of 24cm TL live size (Kinch et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!