Overview

Distribution

Djibouti, Kenyan Exclusive Economic Zone, Madagascar
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the tropical Indian Ocean known only from Madagascar; in the tropical Pacific, in the west from Australia and Sulawesi eastwards to Marianna Islands, Palau, and New Caledonia; tropical, Indo-west Pacific, depth range 3-12 m., also in Australia (Rowe & Gates, 1995); in East Indies (Clark & Rowe, 1971). Also distributed in Celebes (Selenka, 1867). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 6 - 30
  Temperature range (°C): 26.525 - 28.432
  Nitrate (umol/L): 0.084 - 0.923
  Salinity (PPS): 34.519 - 35.095
  Oxygen (ml/l): 4.501 - 4.685
  Phosphate (umol/l): 0.092 - 0.122
  Silicate (umol/l): 0.869 - 1.110

Graphical representation

Depth range (m): 6 - 30

Temperature range (°C): 26.525 - 28.432

Nitrate (umol/L): 0.084 - 0.923

Salinity (PPS): 34.519 - 35.095

Oxygen (ml/l): 4.501 - 4.685

Phosphate (umol/l): 0.092 - 0.122

Silicate (umol/l): 0.869 - 1.110
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holothuria fuscopunctata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATGATTAGGAGGATTTGGCAAATGGCTCATTCCCCTGATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTCCCCCTTCATTCATTCTTCTCCTAGCCTCAGCAGGCGTAGAAAGAGGAGCAGGCACAGGATGAACCATATACCCACCATTATCCAGAAACATTGCCCATGCTGGAGGGTCTGTTGACTTAGCTATTTTCTCTCTACACTTAGCCGGAGCCTCATCCATTCTAGCTTCTATAAACTTTATTACCACAATTATAAACATGCGGACCCCAGGAATAACATTCGACCGTCTTCCTTTATTCGTATGATCAGTTTTCATCACAGCCTTCCTTCTCCTACTTAGGCTACCAGTTCTAGCAGGAGCCATAACAATGCTGCTAACAGACCGGAACATAAAAACAACATTTTTCGACCCCGCAGGAGGAGGAGACCCAATCCTATTCCAACATCTATTCTGATTCTTTGGCCATCCAGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATATCACATGTAATAGCTCACTACAGAGGCAAGCAAGAGCCCTTTGGATATCTCGGAATGGTTTACGCAATGGTAGCCATAGGAATCCTAGGATTCCTAGTCTGAGCCCATCATATGTTCACAGTAGGAATGGACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holothuria fuscopunctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!