Overview
Distribution
Djibouti, Kenyan Exclusive Economic Zone, Madagascar
-
Cherbonnier, G. (1988). Echinodermes: Holothurides. Faune de Madagascar 70.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5997
-
Vaney, C. (1905). Holothuries receuillis par M. Ch. Gravier sur la cote francaise des Somalis. Bull. Mus. natn Hist. nat. Paris 11: 186-190.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6225
-
Conand, C. (1998). Holothurians. In F.A.O. species identification guide. The marine living resources of the Western Central Pacific. Vol 2 Cephalopods, crustaceans, holothurians and sharks, K. Carpenter & V. Niem eds.: 1157-1190.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6370
-
Conand, C., Muthiga, N.A. (Eds.). 2007. Commercial sea cucumbers: a review for the Western Indian Ocean. WIOMSA Book Series No. 5 v + 66pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=164086
Trusted
In the tropical Indian Ocean known only from Madagascar; in the tropical Pacific, in the west from Australia and Sulawesi eastwards to Marianna Islands, Palau, and New Caledonia; tropical, Indo-west Pacific, depth range 3-12 m., also in Australia (Rowe & Gates, 1995); in East Indies (Clark & Rowe, 1971). Also distributed in Celebes (Selenka, 1867). Ecology: benthic, inshore, detritus feeder, deposit feeder (Rowe & Gates, 1995).
-
Cherbonnier, G. (1988). Echinodermes: Holothurides. Faune de Madagascar 70.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5997
Trusted
Ecology
Habitat
Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.
Environmental ranges
Depth range (m): 6 - 30
Temperature range (°C): 26.525 - 28.432
Nitrate (umol/L): 0.084 - 0.923
Salinity (PPS): 34.519 - 35.095
Oxygen (ml/l): 4.501 - 4.685
Phosphate (umol/l): 0.092 - 0.122
Silicate (umol/l): 0.869 - 1.110
Graphical representation
Depth range (m): 6 - 30
Temperature range (°C): 26.525 - 28.432
Nitrate (umol/L): 0.084 - 0.923
Salinity (PPS): 34.519 - 35.095
Oxygen (ml/l): 4.501 - 4.685
Phosphate (umol/l): 0.092 - 0.122
Silicate (umol/l): 0.869 - 1.110
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 27 samples.
Environmental ranges
Depth range (m): 6 - 30
Temperature range (°C): 26.525 - 28.432
Nitrate (umol/L): 0.084 - 0.923
Salinity (PPS): 34.519 - 35.095
Oxygen (ml/l): 4.501 - 4.685
Phosphate (umol/l): 0.092 - 0.122
Silicate (umol/l): 0.869 - 1.110
Graphical representation
Depth range (m): 6 - 30
Temperature range (°C): 26.525 - 28.432
Nitrate (umol/L): 0.084 - 0.923
Salinity (PPS): 34.519 - 35.095
Oxygen (ml/l): 4.501 - 4.685
Phosphate (umol/l): 0.092 - 0.122
Silicate (umol/l): 0.869 - 1.110
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Holothuria fuscopunctata
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 9 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AATGATTAGGAGGATTTGGCAAATGGCTCATTCCCCTGATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTCCCCCTTCATTCATTCTTCTCCTAGCCTCAGCAGGCGTAGAAAGAGGAGCAGGCACAGGATGAACCATATACCCACCATTATCCAGAAACATTGCCCATGCTGGAGGGTCTGTTGACTTAGCTATTTTCTCTCTACACTTAGCCGGAGCCTCATCCATTCTAGCTTCTATAAACTTTATTACCACAATTATAAACATGCGGACCCCAGGAATAACATTCGACCGTCTTCCTTTATTCGTATGATCAGTTTTCATCACAGCCTTCCTTCTCCTACTTAGGCTACCAGTTCTAGCAGGAGCCATAACAATGCTGCTAACAGACCGGAACATAAAAACAACATTTTTCGACCCCGCAGGAGGAGGAGACCCAATCCTATTCCAACATCTATTCTGATTCTTTGGCCATCCAGAAGTTTACATCCTAATCCTCCCAGGATTCGGAATGATATCACATGTAATAGCTCACTACAGAGGCAAGCAAGAGCCCTTTGGATATCTCGGAATGGTTTACGCAATGGTAGCCATAGGAATCCTAGGATTCCTAGTCTGAGCCCATCATATGTTCACAGTAGGAATGGACGTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Holothuria fuscopunctata
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 16
Species With Barcodes: 1
Public Records: 9
Specimens with Barcodes: 16
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
