Overview

Comprehensive Description

Description

 The body of Spirorbis spirorbis is often no more than a few mm in length and orange-red in colour. It is permanently encased in a characteristic smooth, white, evenly coiled tube, 3-4 mm in diameter. The tube is sinistral (coils to the left) with a small, peripheral flange.Large numbers of Spirorbis spirorbis individuals may be found on a single piece of Fucus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 223
  Temperature range (°C): 9.458 - 9.458
  Nitrate (umol/L): 2.286 - 2.286
  Salinity (PPS): 31.635 - 31.635
  Oxygen (ml/l): 6.746 - 6.746
  Phosphate (umol/l): 0.273 - 0.273
  Silicate (umol/l): 1.963 - 1.963

Graphical representation

Depth range (m): 0 - 223
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Spirorbis spirorbis particularly favours the fronds of Fucus serratus and Fucus vesiculosus in the shallow sublittoral and intertidal but also occurs on other algae such as laminarian algae, Himanthalia elongata buttons and, more rarely, stones.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / epizoite
Folliculina ampulla lives on tube of Spirorbis spirorbis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spirorbis spirorbis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TGGTCAACAAATCATAAAGATATTGGAACACTTTATATAATTTTAGGGATATGGGCAGCCTTGCTTGGAACTGCGATAAGTATACTAATTCGTATTGAATTAGGACAACCTGGCCCATTAATTGCAGAC---GACCAACTTTTTAATGTTATTGTAACCGCTCATGCATTCGTAATAATTTTTTTTTTCGTTATAYCTATAAGAATTGGAGGATTCGGAAACTGATTAGTACCCTTAATATTARGAGCTCCTGATATAGCATTCCCACGTCTTARTAATATAAGTTTTTGGCTTCTTCCCCCTTCTCTCATCCTTCTTCTCACTTCTGCTGCAGTAGAAAGTGGTGTTGGTACTGGTTGAACCGTTTATCCCCCCCTTTCAAGAAACTTAGCCCATGCCGGCCYTTCAGTAGACTTTGCTATCTTCTCTCTTCATTTAGCAGGAATCGCCTCTATCTTAGGAGCAGTAAATTTTATCTCTACCGTATTCAACATACGCTGAAATGGTATAAACCTAGAACAAATCCCCCTTTTTGTTTGATCAATTAAAATTACAGCAATTCTACTTCTTCTTTCTCTCCCCGTACTAGCGGGAGCTATYACCATACTTCTTACAGACCGAAACTTCAATACTACGTTTTTTGATCCTAGAGGAGGGGGTGACCCAATCCTTTACCAGCATTTATTTTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Spirorbis spirorbis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spirorbis spirorbis

Spirorbis spirorbis is a small (3-4 mm) coiled polychaete that lives attached to seaweeds and eel grass in shallow saltwater.

They have a smooth, white, sinistral (left-handed) coiled shell encasing an orange body about 3 mm in length. The tube has a peripheral flange where it attaches to the substrate.

The worm has a short abdominal region and a slightly broader thorax terminating in ten stiff tentacles, used to filter food from the water. One of the tentacles is slightly larger than the rest and shaped like a saucer, which is used as an operculum. This seals the opening of the shell and serves to protect the worm from predators and desiccation when out of water.

It lives primarily on toothed wrack (Fucus serratus) and bladder wrack (Fucus vesiculosus), but is also found on the basal part of thongweed (Himanthalia elongata). Numerous individuals can be found on any one surface.

Spirorbis spirorbis are cross fertilising hermaphrodites, who brood their young in a tube attached to the worm inside the shell. The larvae are released at an advanced stage of development and spend just a few hours as free-living organisms before attaching themselves to the nearest suitable surface, often the same seaweed as the parent.

Distribution

All around Britain and Ireland; North Norway to the English Channel.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!