Overview

Comprehensive Description

General Description

(from Coe, W. R. (1901). Papers from the Harriman Alaska Expedition. XX. The nemerteans.. Proc. Wash. Acad. Sci.. 1-110.)

Head with deep, horizontal furrows. Proboscis usually with three muscular layers and muscular crossings. Caudal cirrus absent. Body long and slender, rounded or flattened; very contractile.

A single row of 4-6 (or sometimes 8) ocelli on each side of head. Dusky, or brownish green, dark brown, or reddish brown; commonly paler beneath.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ritger, Rebecca

Source: Nemertea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 11 specimens in 1 taxon.

Environmental ranges
  Depth range (m): -3 - 0

Graphical representation

Depth range (m): -3 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lineus viridis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTTTATTTTCTTTTTGGTATTTGGTCTGGTTTGGTTGGTACTGGATTAAGAATGTTAATTCGGGCTGAGCTAGGGCAGCCTGGGGCGCTGTTAGGAGAT---GATCATTTATACAATGTAATTGTGACTGCGCATGCCTTTGTTATGATTTTTTTTTTGGTTATACCTGTGATGATTGGGGGATTTGGAAATTGGCTTGTTCCTTTAATATTAGGAGCTCCAGATATGGCTTTTCCTCGTATGAATAACATAAGATTTTGGTTGCTTCCTCCTGCTTTAACTTTACTTTTGGGGTCAGCTGCAGTTGAGGGGGGAGCTGGGACTGGTTGAACGGTATATCCTCCTTTGGCCGGTAATGTCGCGCATGCTGGTGGTTCCGTAGATTTAGCTATTTTTTCTTTACACCTTGCTGGTGTATCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTGTAAATATGCGGTGGCGAGGTTTGCAGTTTGAACGGCTTCCTTTATTTGTTTGGTCTGTTAAAATTACTGCTATTTTATTACTACTATCTTTGCCTGTTTTAGCTGGTGCTATTACTATATTGTTAACGGATCGTAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGTGGGGATCCTATTTTGTATCAGCATCTTTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lineus viridis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!