You are viewing this Species as classified by:

Overview

Comprehensive Description

Description

 The edge of the fleshy mantle bears numerous conspicuous, red and orange filamentous tentacles. The shell is thin, solid, equivalve and oval in outline, tapering towards the beaks, and usually about 2.5 cm in length but occasionally reaching 4 cm. The beaks bear an 'ear' like projection on each side, the anterior 'ear' being more prominent. The shell gaps on both sides. The shell is white in young specimens becoming whitish-brown with age. The shell bears clear growth steps and ca 50 radiating ribs that extend to a crenulate margin. When disturbed this species can swim actively using jets of water expelled by 'clapping' its shells together and a rowing motion of its tentacles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 70

Graphical representation

Depth range (m): 0 - 70
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found from low water to ca 100 m on coarse sand, gravel, broken shells and stones. It may occupy 'nests' of byssus threads among rubble, under stones or in the holdfasts of laminarians. When abundant, the 'nests' may coalesce to form a carpet or reef over shell-sand, which may provide a substratum for kelps.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limaria hians

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTGGAAGAATGTATTTTTTGGTCGGGTTTTGGTCTTCTCTAAGAGGAGTGTCATACAGGCTAATTATTCGGATTCAGTTGTCCCGGCCAGGGCAGTGGGTAGGGGAC---GCTCATGCGTATAACGTGGCTGTAACTAGACATGCCCTTATTATGATCTTCTTCTTTGTCATGCCTGTTTTAATTGGGGGGTTTGGGAACTGGTTTATCCCTCTTTTTATTGGGTCACCAGACATGATTTTCCCTCGATTGAATAATTTCAGTTTCTGGCTATTGCCTCCGGCTTGTTTCATAGCGATTGGGTCTATGGGAGTGGGGAGAGGAACAGGAGCAGGTTGAACTTTGTATCCCCCTTTATCAGGGCTAACTGGAAGGTGAAGGTACAGGATTGATCTCACAATTTTCTCTCTTCACCTGGCAGGAATTTCTTCTATGTCTGGGGCTATTAATTTTTTAACTACTATATACAATTGTCGGCCTACTTTGATAAAGGGAGAGCGGGTTCCGTTATATCCGTGGGCTGCTATTGTTACTAGGATCTTATTGGTGGGGGCCATTCCTGTCCTTGCAGGGGCTTTGACTATGCTCTTGTTAGATCGGCACGTGAACAGAACCTTCTTTGACCCAATTGGAGGGGGGGATCCTGTTTTGTTCCAGCATTTGNTCTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limaria hians

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!