Overview

Comprehensive Description

Description

 The edge of the fleshy mantle bears numerous conspicuous, red and orange filamentous tentacles. The shell is thin, solid, equivalve and oval in outline, tapering towards the beaks, and usually about 2.5 cm in length but occasionally reaching 4 cm. The beaks bear an 'ear' like projection on each side, the anterior 'ear' being more prominent. The shell gaps on both sides. The shell is white in young specimens becoming whitish-brown with age. The shell bears clear growth steps and ca 50 radiating ribs that extend to a crenulate margin. When disturbed this species can swim actively using jets of water expelled by 'clapping' its shells together and a rowing motion of its tentacles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 70

Graphical representation

Depth range (m): 0 - 70
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found from low water to ca 100 m on coarse sand, gravel, broken shells and stones. It may occupy 'nests' of byssus threads among rubble, under stones or in the holdfasts of laminarians. When abundant, the 'nests' may coalesce to form a carpet or reef over shell-sand, which may provide a substratum for kelps.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limaria hians

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTGGAAGAATGTATTTTTTGGTCGGGTTTTGGTCTTCTCTAAGAGGAGTGTCATACAGGCTAATTATTCGGATTCAGTTGTCCCGGCCAGGGCAGTGGGTAGGGGAC---GCTCATGCGTATAACGTGGCTGTAACTAGACATGCCCTTATTATGATCTTCTTCTTTGTCATGCCTGTTTTAATTGGGGGGTTTGGGAACTGGTTTATCCCTCTTTTTATTGGGTCACCAGACATGATTTTCCCTCGATTGAATAATTTCAGTTTCTGGCTATTGCCTCCGGCTTGTTTCATAGCGATTGGGTCTATGGGAGTGGGGAGAGGAACAGGAGCAGGTTGAACTTTGTATCCCCCTTTATCAGGGCTAACTGGAAGGTGAAGGTACAGGATTGATCTCACAATTTTCTCTCTTCACCTGGCAGGAATTTCTTCTATGTCTGGGGCTATTAATTTTTTAACTACTATATACAATTGTCGGCCTACTTTGATAAAGGGAGAGCGGGTTCCGTTATATCCGTGGGCTGCTATTGTTACTAGGATCTTATTGGTGGGGGCCATTCCTGTCCTTGCAGGGGCTTTGACTATGCTCTTGTTAGATCGGCACGTGAACAGAACCTTCTTTGACCCAATTGGAGGGGGGGATCCTGTTTTGTTCCAGCATTTGNTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Limaria hians

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Flame shell

The flame shell, scientific name Limaria hians, is a species of small saltwater clam, a marine bivalve mollusc in the family Limidae. It is native to the northeaster Atlantic.

Biology[edit]

The flame shell resembles a scallop with a bright orange fringe of filaments emerging from between the valve of its shell.

The bivalves make sticky threads which bind stones and pieces of shell debris into a felt-lined nest. Holes in the reef allow fresh seawater to flow through, preventing stagnation. The live animals cannot be seen unless the mat-like nest is torn open.

Distribution[edit]

This species is found in the northeast Atlantic, ranging from Lofoten to the Canary Islands, including the Mediterranean Sea. In the British Isles, the distribution of this species is primarily in the west coast of Scotland from the sublittoral (below low tide), down to 100m, although there are patchy records of the species being found in more southerly regions of the United Kingdom. There are a number of well-known colonies on the sea bed in Loch Carron, below Strome Castle. In 2012 a bed of 100 million flame shells covering an area of 75 hectares was found during a survey of Loch Alsh undertaken by Heriot-Watt University on behalf of Marine Scotland. Richard Lochhead, Cabinet Secretary for Rural Affairs and the Environment said: "The flame shell must be considered among the most remarkable species in our waters, with a dazzling array of orange tentacles. Many would place such an exotic species in far-flung tropical reefs - not realising they dwell under the waves just off the coast of Skye. This important discovery may be the largest grouping of flame shells anywhere in the world." [1]

See also[edit]

Notes[edit]

References[edit]

Hall-Spencer JM & Moore PG (2000) Limaria hians (Mollusca: Limacea): a neglected reef-forming keystone species. Aquatic Conservation 10, 267-277.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!