Overview

Comprehensive Description

Description

 A small conical limpet (up to 25 mm in length) with the apex anterior and smooth shell with fine radiating ridges. The external shell is dull white, grey, brown or green with a reddish-brown mottling. The mantle edge is copper-green with two rows of fine tentacles.Eggs are laid in spring and early summer, on firm substrata, as a single layer in a mucus sheet.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 101 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): -3 - 64
  Temperature range (°C): 8.449 - 12.177
  Nitrate (umol/L): 4.850 - 8.788
  Salinity (PPS): 34.054 - 35.211
  Oxygen (ml/l): 4.958 - 6.200
  Phosphate (umol/l): 0.336 - 0.728
  Silicate (umol/l): 2.315 - 6.045

Graphical representation

Depth range (m): -3 - 64

Temperature range (°C): 8.449 - 12.177

Nitrate (umol/L): 4.850 - 8.788

Salinity (PPS): 34.054 - 35.211

Oxygen (ml/l): 4.958 - 6.200

Phosphate (umol/l): 0.336 - 0.728

Silicate (umol/l): 2.315 - 6.045
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found on the mid shore into the sublittoral (to depths of 50 m) on boulders and small smooth stones, especially those that bear red algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Acmaea testudinalis preys on:
algae

Based on studies in:
USA: New England (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • B. A. Menge and J. P. Sutherland, Species diversity gradients: synthesis of the roles of predation, competition and temporal heterogeneity, Am. Nat. 110(973):351-369, from p. 355 (1976).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Acmaea testudinalis is prey of:
Thais lapillus

Based on studies in:
USA: New England (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • B. A. Menge and J. P. Sutherland, Species diversity gradients: synthesis of the roles of predation, competition and temporal heterogeneity, Am. Nat. 110(973):351-369, from p. 355 (1976).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tectura testudinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTACTTTAAGATTACTAATTCGTATTCATTTAATGCACAGGGGGGGGTTCCTGGTGACC---GGCACCTTGTACAATGCAGTAGTAACAGCCCATGCGTTTTTAATAATTTTTTTTATGGTAATGCCTGTTTTAATCGGGGGGTTTGGTAATTGGTTAGTTCCCATGTTAATTCCTGCTCCTGATTTAGGATTAGCTCGTATAAATAACTTAAGGTTTTGGCTATTACCACATTCCTTAGTGTTTTTACTTGTTTCTACTTTAACAGATACAGCAGTAGGGACTGGTTGGACTCTATACCCCCCCCTGTCTTCCTTAGAGGGACACCACTCACCATGTGTTGATGAGGCAATTTTTTCTTTACATATAAGAGGCATTGCTTCAATTTTTGCAAGTGTAAATTTCATTACTACAATCAAACATGCCCGCGGCCCCCATAAACCGTTGGTGGCACTTCCCTTGTTTGTTGCTGCAATTGGTACCACTAGTATTTTACTTCTTCTTTCAGTGCCTGTGTTGGCCGGGGCCTTAACAATGTTGATTACTGATCGTAATATCAACACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tectura testudinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australia Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Testudinalia testudinalis

Testudinalia testudinalis, common name the common tortoise limpet, is a species of sea snail, a true limpet, a marine gastropod mollusk in the family Lottiidae, one of the families of true limpets.[1] It is commonly known as the plant limpet or tortoiseshell limpet.[2]

Contents

Description

T. testudinalis has a low domed shell, oval in outline. It can grow to up to 30 x 24 x 10 mm but typically is about half this size. The apex is towards the anterior of the shell and fine ridges radiate from it. The shell is banded with brown and white. The mantle is the part of the body wall immediately under the shell and at the edges it is curled round to form a collar. The foot is broad and oval. The head bears two sensory tentacles with a tiny black eye at the base of each.[3]

Distribution and habitat

T. testudinalis occurs in northern regions of both the Pacific and Northwest Atlantic Oceans and in European waters. It is found in the neritic zone from low water mark down to a depth of about fifty metres. It is usually found on stones and boulders, especially those encrusted with red crustose algae such as Lithothamnion.[4]

Basal view

Biology

Red eggs are laid in a sheet in the spring and the larvae are planktonic.[2]

References

  • Ziegelmeier, E. (1966). Die Schnecken (Gastropoda Prosobranchia) der deutsche Meeresgebiete und brackigen Küstengewässer [The Gastropoda Prosobranchia from the German seas and brackish coastal waters]. Helgol. Wiss. Meeresunters. 13: 1-66
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
  • Brunel, P., L. Bosse, & G. Lamarche. (1998). Catalogue of the marine invertebrates of the estuary and Gulf of St. Lawrence. Canadian Special Publication of Fisheries and Aquatic Sciences, 126. 405 p.
  • Turgeon, D.D., et al. 1998. Common and scientific names of aquatic invertebrates of the United States and Canada. American Fisheries Society Special Publication 26 page(s): 56
  • de Kluijver, M.J.; Ingalsuo, S.S.; de Bruyne, R.H. (2000). Macrobenthos of the North Sea [CD-ROM]: 1. Keys to Mollusca and Brachiopoda. World Biodiversity Database CD-ROM Series. Expert Center for Taxonomic Identification (ETI): Amsterdam, The Netherlands. ISBN 3-540-14706-3. 1 cd-rom pp.
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
  • Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
  • Kantor Yu.I. & Sysoev A.V. (2006) Marine and brackish water Gastropoda of Russia and adjacent countries: an illustrated catalogue. Moscow: KMK Scientific Press. 372 pp. + 140 pls. page(s): 22
  • Nakano & Ozawa (2007). Worldwide phylogeography of limpets of the order Patellogastropoda: Molecular, morphological and palaeontological evidence. Journal of Molluscan Studies 73(1) 79-99.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!