Overview

Brief Summary

Introduction

The large number of undescribed species in the genus makes identification of any specimens difficult. Since the type locality of H. pefferi is in the North Atlantic, the North Pacific form of H. pfefferi described here may be one of these undescribed species.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Mantle
    1. Papillae absent.

  2. Arms
    1. Suckers in middle of arms III not enlarged in females.

  3. Pigmentation
    1. Orange/brown chromatophores form bands of sides of mantle.

Comments

More details of the description can be found here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Mexico, New Zealand Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-(sub)tropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum global
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vertical distribution

Off California, captures made with open nets indicated an ontogenetic descent and no diel vertical migration. The majority of specimens over 40 mm ML were taken at depths of 400-600 m.

Geographical distribution

The type locality is the temperate North Atlantic, near Ireland (51°54'N, 11°57'W). Due to the large number of undescribed species in this genus, the distribution of H. pfefferi is uncertain.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 450 - 1400

Graphical representation

Depth range (m): 450 - 1400
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 133 specimens in 1 taxon.
Water temperature and chemistry ranges based on 129 samples.

Environmental ranges
  Depth range (m): 50 - 2441
  Temperature range (°C): 3.278 - 21.554
  Nitrate (umol/L): 0.156 - 39.064
  Salinity (PPS): 34.258 - 36.622
  Oxygen (ml/l): 0.333 - 6.046
  Phosphate (umol/l): 0.030 - 3.143
  Silicate (umol/l): 0.798 - 80.938

Graphical representation

Depth range (m): 50 - 2441

Temperature range (°C): 3.278 - 21.554

Nitrate (umol/L): 0.156 - 39.064

Salinity (PPS): 34.258 - 36.622

Oxygen (ml/l): 0.333 - 6.046

Phosphate (umol/l): 0.030 - 3.143

Silicate (umol/l): 0.798 - 80.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History

Paralarvae are easily recognized as belonging to Helicocranchia by their shape and chromatophore patterns. In Hawaiian waters, however, there appears to be two different species in the genus. Two features, however, distinguish this paralarva from its less common congener (H. beebei?): The color pattern has more distinct bars and the eyes lack a short optic stalk (i.e., the optic lobe is adjacent to the central brain).

Figure. Ventral and dorsal views of paralarvae of H. pfefferi, Hawaiian waters. Left - 3.4 mm ML . Right - 4.4 mm ML. Arrows point to chromatophores that are part of prominent lateral bars. Ventral-head chromatophores hidden by the funnel are represented by dashed lines. The scale bar is 1 mm. Drawings by R. Young.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Helicocranchia pfefferi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGTATTTGAGCAGGATTACTAGGAACTTCTTTAAGACTAATAATCCGTACTGAACTAGGACAACCAGGGTCATTACTAAATGAT---GATCAACTATATAATGTAGTAGTAACCGCCCATGGGTTTATTATAATTTTTTTTCTCGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCTTTAATATTAGGGGCTCCAGACATAGCCTTTCCCCGAATAAATAATATAAGCTTTTGACTTCTTCCTCCATCCTTAACTTTACTACTTGCCTCTTCAGCAGTAGAAAGGGGGGCAGGGACAGGATGAACAGTATACCCTCCTTTATCTAGTAACTTATCTCATGCAGGCCCTTCCGTTGATTTAGCAATTTTCTCTCTTCACCTTGCAGGAGTTTCCTCCATTCTAGGAGCAATTAATTTCATTACAACTATTTTAAATATACGATGAGAAGGGTTACAAATAGAACGATTACCTCTTTTTGCTTGATCTGTTTTTATTACAGCCATTCTACTTTTATTATCCCTTCCAGTCTTAGCAGGAGCTATTACTATATTATTAACTGACCGAAATTTCAATACAACATTTTTTGATCCTAGAGGGGGTGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Helicocranchia pfefferi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Helicocranchia pfefferi

Helicocranchia pfefferi, the banded piglet squid, is a small squid of the genus Helicocranchia. Adults of this species are mesopelaegic.

Contents

Physical characteristics

The average size of adult H. pfefferi is 100 mm (3.9 in) in mantle length (ML). The body consists of a large funnel with small paddle-like fins. They have small tentacles above their eyes. The funnel does not have valves, but contains a dorsal pad with three papillae as organs.[citation needed] Paddle-shaped fins are attached to a part of the gladius. H. pfefferi has a single ocular photophore and does not have photophores at its arm tips.

Habitat

As paralarvae (<30 mm ML), they live near the surface of the oceans, between 100 m and 200 m deep. They descend to the mesopelagic zone as they mature, but do not exhibit a diel vertical migration pattern.[1]

References

  1. ^ Lu, C.C. & M.R. Clarke (1975). "Vertical Distribution of Cephalopods at 11° N 20° W in the North Atlantic". Journal of the Marine Biological Association of the United Kingdom 55 (2): 369–389. doi:10.1017/S0025315400016003.
  • Young, R.E. & K.M. Mangold (1922-2003). 2006. Helicocranchia Massy, 1907. Version 16 July 2006 (under construction). In: The Tree of Life Web Project.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!