Overview

Brief Summary

Introduction

Teuthowenia megalops is a moderate sized cranchiid reaching a maximum size of over 380 mm ML (Voss, 1985). It occurs in the high North Atlantic, predominately north of 47°N in the central North Atlantic, where it seem to be one of the most abundant cranchiids (Vecchione et al., xxx).

Figure. Two superimposed images of the same specimen of T. megalops, about 140 mm ML, showing lateral attachment of the fin and the very large eyes. Top - Side view. Bottom - Dorsal view. Captured aboard the R/V G. O. SARS during the MARECO cruise to the central North Atlantic.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Mantle
    1. Single-point tubercle, rarely absent, at each funnel-mantle fusion.

      Figure. Ventral view of the tubercle at the funnel-mantle fusion of T. megalops, mature male, 199 mm GL. Drawing from Voss, 1985, pp. 17, 18.

  2. Arms
    1. Arms II of males with 2 series of suckers on modified tips (sometimes appearing as 3-4 series due to crowding).

      Figure. Oral view of the modified tip of arm II of T. megalops which occupies 23-32% of the arm length. Immature male, 184 mm GL. From Voss, 1985, pp. 17, 18. Printed with the Permission of the Bulletin of Marine Science.

    2. Arms II of males with 15-19 pairs of normal suckers proximal to modified tips.
    3. Arms I of males without modified tips.

      Figure. Oral view of the entire arm I of a mature male of T. megalops (199 mm GL) showing sexual modifications but without modified tip. From Voss, 1985, pp. 17, 18.

    4. Largest arm III suckers 3 times basal suckers in diameter (at least 2.0-2.8% of GL in diameter).
  3. Tentacles
    1. Largest club suckers with 19-24 teeth.

      Figure. Oral view of the largest sucker from the club manus of T. megalops, female, 187 mm ML. Drawing from Voss, 1985, pp. 17, 18.

  4. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.

Comments

Additional details of the description of T. megalops can be found here.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), North Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vertical distribution

Lu and Clarke (1975) found the paralarval stages mostly in the upper 200 m.

With one exception at 400m, Voss (1985) found all maturing females and mature and near-mature males at depths of 1000 - 2700 m.

Geographical distribution

T. megalops occupies the productive waters of the subarctic and northern temperate Atlantic Ocean where it lies within the Northern Subpolar-Temperate faunal zone (Voss, 1985).

Geographical distribution map modified from Voss, 1985.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 53 samples.

Environmental ranges
  Depth range (m): 40 - 3070
  Temperature range (°C): 2.617 - 23.791
  Nitrate (umol/L): 0.122 - 22.716
  Salinity (PPS): 34.904 - 36.622
  Oxygen (ml/l): 3.399 - 6.356
  Phosphate (umol/l): 0.028 - 1.503
  Silicate (umol/l): 0.774 - 35.765

Graphical representation

Depth range (m): 40 - 3070

Temperature range (°C): 2.617 - 23.791

Nitrate (umol/L): 0.122 - 22.716

Salinity (PPS): 34.904 - 36.622

Oxygen (ml/l): 3.399 - 6.356

Phosphate (umol/l): 0.028 - 1.503

Silicate (umol/l): 0.774 - 35.765
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life history


The paralarval period ends when the eyes become sessile between sizes of 75 and 95 mm GL. Paralarvae have relatively large, oval and widely spaced chromatophores on the mantle. The tubercle first appears at the funnel-mantle fusion at a size between 30 and 60 mm GL (Voss, 1985).

Figure. T. megalops growth stages. Left - Two views of a paralarva photographed in a shipboard aquarium: side view, and an anterior view with the head and arms withdrawn into the mantle cavity. Also, in the latter photograph the squid had released ink into the mantle cavity. © David Shale. Right - (left to right): 11 mm ML, 29 mm ML, 60 mm ML. Drawings from Voss, 1985, p. 22.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Teuthowenia megalops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTAGGACATCCTTAAGATTAATAATCCGAACTGAATTAGGACAACCAGGCTCTCTACTAAATGAC---GACCAACTATACAATGTAGTAGTTACTGCCCATGGGTTTATTATAATTTTTTTCTTAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTACCACTAATACTAGGAGCCCCAGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTTCTACCTCCATCCTTAACACTTCTATTAGCATCCTCAGCTGTTGAAAGGGGAGCTGGAACAGGATGAACAGTATACCCTCCTTTATCTAGAAATTTATCCCATGCAGGTCCCTCTGTTGATTTAGCTATTTTTTCTCTACACCTAGCGGGTGTCTCTTCTATTCTAGGAGCAATTAATTTTATTACAACTATTTTAAACATGCGCTGAGAAGGCTTACAAATAGAACGACTACCTCTTTTTGCTTGATCTGTTTTTATCACCGCGATTTTGCTTCTTCTATCCCTACCAGTTTTAGCCGGTGCTATTACCATACTATTAACTGACCGAAATTTTAACACAACGTTTTTTGATCCTAGAGGGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Teuthowenia megalops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!