Overview

Brief Summary

Introduction

Teuthowenia megalops is a moderate sized cranchiid reaching a maximum size of over 380 mm ML (Voss, 1985). It occurs in the high North Atlantic, predominately north of 47°N in the central North Atlantic, where it seem to be one of the most abundant cranchiids (Vecchione et al., xxx).

Figure. Two superimposed images of the same specimen of T. megalops, about 140 mm ML, showing lateral attachment of the fin and the very large eyes. Top - Side view. Bottom - Dorsal view. Captured aboard the R/V G. O. SARS during the MARECO cruise to the central North Atlantic.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Mantle
    1. Single-point tubercle, rarely absent, at each funnel-mantle fusion.

      Figure. Ventral view of the tubercle at the funnel-mantle fusion of T. megalops, mature male, 199 mm GL. Drawing from Voss, 1985, pp. 17, 18.

  2. Arms
    1. Arms II of males with 2 series of suckers on modified tips (sometimes appearing as 3-4 series due to crowding).

      Figure. Oral view of the modified tip of arm II of T. megalops which occupies 23-32% of the arm length. Immature male, 184 mm GL. From Voss, 1985, pp. 17, 18. Printed with the Permission of the Bulletin of Marine Science.

    2. Arms II of males with 15-19 pairs of normal suckers proximal to modified tips.
    3. Arms I of males without modified tips.

      Figure. Oral view of the entire arm I of a mature male of T. megalops (199 mm GL) showing sexual modifications but without modified tip. From Voss, 1985, pp. 17, 18.

    4. Largest arm III suckers 3 times basal suckers in diameter (at least 2.0-2.8% of GL in diameter).
  3. Tentacles
    1. Largest club suckers with 19-24 teeth.

      Figure. Oral view of the largest sucker from the club manus of T. megalops, female, 187 mm ML. Drawing from Voss, 1985, pp. 17, 18.

  4. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.

Comments

Additional details of the description of T. megalops can be found here.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed in the productive temperate and subarctic waters of the North Atlantic (Young and Mangold 2007) where it is apparently one of the most common cranchiid squids (Vecchione et al. 2010).


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vertical distribution

Lu and Clarke (1975) found the paralarval stages mostly in the upper 200 m.

With one exception at 400m, Voss (1985) found all maturing females and mature and near-mature males at depths of 1000 - 2700 m.

Geographical distribution

T. megalops occupies the productive waters of the subarctic and northern temperate Atlantic Ocean where it lies within the Northern Subpolar-Temperate faunal zone (Voss, 1985).

Geographical distribution map modified from Voss, 1985.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This mesopelagic species occurs in the productive waters of the temperate and subarctic in the North Atlantic (Young and Mangold 2007). This species appears to undergo downward ontogenetic vertical migration. Planktonic paralarvae occur from the subsurface to ~1,000 m (Voss et al. 1992), but are most abundant in the upper 200 m with larger juveniles occurring at deeper depths (Young and Mangold 2007). Subadults descend to deeper depths between 1,000 and 2,700 m to mature (Young and Mangold 2007). Juveniles and subadults may undergo diel vertical migrations (Voss et al. 1992). It is predated upon by a range of marine mammals (e.g. sperm whales and long finned pilot whales) and finfish (e.g. blue shark and swordfish). Females may spawn between 70,000 and 80,000 eggs over a short period of time, with eggs ~1.7 mm in length (Nixon 1983). Its life span may last from between 730 and 1,095 days (Nixon 1983).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 60 specimens in 1 taxon.
Water temperature and chemistry ranges based on 53 samples.

Environmental ranges
  Depth range (m): 40 - 3070
  Temperature range (°C): 2.617 - 23.791
  Nitrate (umol/L): 0.122 - 22.716
  Salinity (PPS): 34.904 - 36.622
  Oxygen (ml/l): 3.399 - 6.356
  Phosphate (umol/l): 0.028 - 1.503
  Silicate (umol/l): 0.774 - 35.765

Graphical representation

Depth range (m): 40 - 3070

Temperature range (°C): 2.617 - 23.791

Nitrate (umol/L): 0.122 - 22.716

Salinity (PPS): 34.904 - 36.622

Oxygen (ml/l): 3.399 - 6.356

Phosphate (umol/l): 0.028 - 1.503

Silicate (umol/l): 0.774 - 35.765
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life history


The paralarval period ends when the eyes become sessile between sizes of 75 and 95 mm GL. Paralarvae have relatively large, oval and widely spaced chromatophores on the mantle. The tubercle first appears at the funnel-mantle fusion at a size between 30 and 60 mm GL (Voss, 1985).

Figure. T. megalops growth stages. Left - Two views of a paralarva photographed in a shipboard aquarium: side view, and an anterior view with the head and arms withdrawn into the mantle cavity. Also, in the latter photograph the squid had released ink into the mantle cavity. © David Shale. Right - (left to right): 11 mm ML, 29 mm ML, 60 mm ML. Drawings from Voss, 1985, p. 22.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Teuthowenia megalops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTAGGACATCCTTAAGATTAATAATCCGAACTGAATTAGGACAACCAGGCTCTCTACTAAATGAC---GACCAACTATACAATGTAGTAGTTACTGCCCATGGGTTTATTATAATTTTTTTCTTAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTACCACTAATACTAGGAGCCCCAGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTTCTACCTCCATCCTTAACACTTCTATTAGCATCCTCAGCTGTTGAAAGGGGAGCTGGAACAGGATGAACAGTATACCCTCCTTTATCTAGAAATTTATCCCATGCAGGTCCCTCTGTTGATTTAGCTATTTTTTCTCTACACCTAGCGGGTGTCTCTTCTATTCTAGGAGCAATTAATTTTATTACAACTATTTTAAACATGCGCTGAGAAGGCTTACAAATAGAACGACTACCTCTTTTTGCTTGATCTGTTTTTATCACCGCGATTTTGCTTCTTCTATCCCTACCAGTTTTAGCCGGTGCTATTACCATACTATTAACTGACCGAAATTTTAACACAACGTTTTTTGATCCTAGAGGGGGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Teuthowenia megalops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Young, R., Vecchione, M. & Böhm, M.

Contributor/s

Justification
Teuthowenia megalops is an oceanic species which has a wide geographic distribution and inhabits deep-water, making it is less susceptible to human impact. It is also not targeted by fisheries and is unlikely to be in the future. It is well defined taxonomically, and is relatively common. It has therefore been assessed as Least Concern. However, more research is still needed on its ecology and biology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size is unknown, but it reported to be the most common cranchiid in the North Atlantic (Vecchione et al. 2010).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Further research is recommended, specifically on the distribution, population abundance and ecology of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!