Overview

Distribution

41°N to 23°S; 74°W to 43°W, Massachusetts to Brazil, 100 to 2743 m
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal to abyssal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 50 specimens in 1 taxon.
Water temperature and chemistry ranges based on 42 samples.

Environmental ranges
  Depth range (m): 193 - 3975
  Temperature range (°C): 2.284 - 4.188
  Nitrate (umol/L): 17.196 - 19.721
  Salinity (PPS): 34.903 - 34.977
  Oxygen (ml/l): 4.869 - 6.345
  Phosphate (umol/l): 1.147 - 1.497
  Silicate (umol/l): 12.385 - 29.898

Graphical representation

Depth range (m): 193 - 3975

Temperature range (°C): 2.284 - 4.188

Nitrate (umol/L): 17.196 - 19.721

Salinity (PPS): 34.903 - 34.977

Oxygen (ml/l): 4.869 - 6.345

Phosphate (umol/l): 1.147 - 1.497

Silicate (umol/l): 12.385 - 29.898
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fissidentalium candidum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AATCATAAAGATATTGGCACCATATATTTTTTAATTGGAATTTGNTCAGGAATAGTCGGCACTTCATTAAGAGTAATAATTCGAGCGGAATTAGGGACACCTGGTTGTTTATTGGGGGAT---GATCAGTTGTATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTTTAGTTATACCATTAATAATTGGGGGNTTTGGAAACTGATTGATTCCTTTAATAATAGGTTCCCCAGACATAGCTTTTCCTCGAATAAATAACATAAGGTTTTGATTGCTGCCCCTCTCATTAGCTTTGTTATTAATTGCTAGTGTAATAGAGNGGGGNGCAGGGACTGGATGAACAGTTTACCCCCCTTTGTCTAGGAATATCGCTCATACAGGATCTTCTGTGGACTGAGTAATTTTTTCTTTACATTTAGCGGGGGTTTCNTCTATTTTNGGNGCCATNAACTTTATTAGAACTGTAATTAATATACGACCTAAAAATATGATTTTAGAACGGGTGCCTTTGTTTGTTTGATCAGTAAAAGTTACAGCAGTTCTTTTACTTCTTTCATTACCTGTTTTGGCAGGAGCTATTACAATGCTTTTAACAGACCGAAATTTTAACACTTCATTTTTTGATCCTGCAGGAGGGGGGGACCCTGTTTTGTATCAACATTTATTTTGATTTTTTGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fissidentalium candidum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!