Overview

Distribution

Asia: Laos, Viet Nam and East Asia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 80.20000457763672 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 43281))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adult male with projecting anal fin rays; conspicuous symphyseal knob in lower jaw; origin of dorsal fin slightly in front of anal origin; sexual dichromatism, female with plain body, male with irregular dark bars (Ref. 43281).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)


Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Opsariichthys bidens

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC7855-09|NC_008744|Opsariichthys bidens| ACACGCTGATTCTTTTCTACAAATCACAAAGACATTGGTACCCTTTATCTTGTATTCGGTGCCTGAGCTGGAATAGTAGGAACCGCGCTA---AGCCTCCTTATTCGAGCCGAACTAAGCCAACCTGGATCACTTCTAGGCGAC---GATCAAATTTATAATGTTATTGTTACTGCCCATGCCTTTGTTATAATTTTCTTTATAGTAATACCAATTCTTATTGGAGGGTTAGGTAAGGGGCTTGTGCCGCTAATG---ATTGGGGCACCTGACATGGCATTTCCTCGAATAAATAACATAAGCTTTTGACTTCTTCCTCCCTCTTTCCTCCTGTTATTAGCCTCTTCTGGTGTTGAGGCCGGGGCTGGGACAGGGTGAACAGTCTACCCGCCGCTTGCAGGCAATCTCGCTCACGCAGGCGCATCTGTAGACCTA---ACAATTTTCTCACTCCACTTAGCAGGAGTTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAACTATTAATATGAAACCCCCAGCCATCTCTCAATATCAGACACCCCTGTTTGTTTGAGCCGTACTTGTGACGGCTGTGCTTCTTCTTCTATCCCTGCCCGTATTGGCCGCC---GGGATTACAATGCTCCTTACGGACCGAAATCTTAACACCACATTCTTCGACCCTGCGGGAGGAGGAGACCCAATTCTATATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATTCTTATTCTACCAGGATTCGGGATTATCTCCCACGTGGTAGCCTATTATTCCGGGAAAAAG---GAACCCTTCGGTTACATGGGGATAGTTTGAGCTATAATGGCCATTGGCCTTTTAGGATTTATTGTGTGAGCCCACCATATGTTTACTGTCGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Opsariichthys bidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!