Overview
Distribution
Asia: Laos, Viet Nam and East Asia.
-
Kottelat, M. 2001 Fishes of Laos. WHT Publications Ltd., Colombo 5, Sri Lanka. 198 p. (Ref. 43281)
http://www.fishbase.org/references/FBRefSummary.php?id=43281&speccode=6261
Trusted
Physical Description
Size
Max. size
16.0 cm SL (male/unsexed; (Ref. 43281))
-
Kottelat, M. 2001 Fishes of Laos. WHT Publications Ltd., Colombo 5, Sri Lanka. 198 p. (Ref. 43281)
http://www.fishbase.org/references/FBRefSummary.php?id=43281&speccode=6261
Trusted
Diagnostic Description
Adult male with projecting anal fin rays; conspicuous symphyseal knob in lower jaw; origin of dorsal fin slightly in front of anal origin; sexual dichromatism, female with plain body, male with irregular dark bars (Ref. 43281).
-
Kottelat, M. 2001 Fishes of Laos. WHT Publications Ltd., Colombo 5, Sri Lanka. 198 p. (Ref. 43281)
http://www.fishbase.org/references/FBRefSummary.php?id=43281&speccode=6261
Trusted
Ecology
Habitat
Amur River Benthopelagic Habitat
This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton
The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.
Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)
The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.
Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)
- C.Michael Hogan. 2012. ''Amur River. Encyclopedia of Earth, National Council for Science and the Environment, Washington DC ed. Peter Saundry; ed.in-chief Cutler J.Cleveland
- Fishbase. 2010. Species in Amur
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Opsariichthys bidens
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
GBGC7855-09|NC_008744|Opsariichthys bidens| ACACGCTGATTCTTTTCTACAAATCACAAAGACATTGGTACCCTTTATCTTGTATTCGGTGCCTGAGCTGGAATAGTAGGAACCGCGCTA---AGCCTCCTTATTCGAGCCGAACTAAGCCAACCTGGATCACTTCTAGGCGAC---GATCAAATTTATAATGTTATTGTTACTGCCCATGCCTTTGTTATAATTTTCTTTATAGTAATACCAATTCTTATTGGAGGGTTAGGTAAGGGGCTTGTGCCGCTAATG---ATTGGGGCACCTGACATGGCATTTCCTCGAATAAATAACATAAGCTTTTGACTTCTTCCTCCCTCTTTCCTCCTGTTATTAGCCTCTTCTGGTGTTGAGGCCGGGGCTGGGACAGGGTGAACAGTCTACCCGCCGCTTGCAGGCAATCTCGCTCACGCAGGCGCATCTGTAGACCTA---ACAATTTTCTCACTCCACTTAGCAGGAGTTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAACTATTAATATGAAACCCCCAGCCATCTCTCAATATCAGACACCCCTGTTTGTTTGAGCCGTACTTGTGACGGCTGTGCTTCTTCTTCTATCCCTGCCCGTATTGGCCGCC---GGGATTACAATGCTCCTTACGGACCGAAATCTTAACACCACATTCTTCGACCCTGCGGGAGGAGGAGACCCAATTCTATATCAACACCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATTCTTATTCTACCAGGATTCGGGATTATCTCCCACGTGGTAGCCTATTATTCCGGGAAAAAG---GAACCCTTCGGTTACATGGGGATAGTTTGAGCTATAATGGCCATTGGCCTTTTAGGATTTATTGTGTGAGCCCACCATATGTTTACTGTCGGAATAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Opsariichthys bidens
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1
Public Records: 1
Species: 1
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



