Overview
Comprehensive Description
Description
Jorunna tomentosa is usually sandy brown in colour with a loosely paired series of dark brown blotches down the sides of the body. It grows to about 6 cm in length.The mantle of Jorunna tomentosa is velvety, caused by the dense covering of small, uniform tubercles with an array of protruding spicules (caryophyllidia). Each tubercle has a characteristic retractile central projecting finger. There are up to 17 tripinnate gills, located within a gill pocket. The oral tentacles are short, slender and finger-like. The foot projects posteriorly when crawling. Jorunna tomentosa feeds on encrusting siliceous sponges, especially Halichondria panicea and Haliclona spp. Its colour and texture ensure this sea slug is well camouflaged amongst the sponges.Spawning is recorded February to August (Thompson & Brown, 1984). The spawn is a broad ribbon laid in neat, tight coil. Each spiral spawn mass contains up to 145,000 eggs (Thompson & Brown, 1984).
Trusted
Description
J. tomentosa is yellow to sandy brown in colour. The mantle is velvety in appearance and to the touch. This effect is created by the presence of numerous, small, uniform tubercles. Usually there are several pairs of dark brown spots on the sides of the mantle, however the variety lemchei lacks these spots. Individuals may reach a length of up to 55mm.
Trusted
Distribution
Belgian Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Oosterschelde, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
-
Leewis, R. (2002). Flora en fauna van de zee [Marine flora and fauna]. Veldgids, 16. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-153-X. 320 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1116
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
Trusted
Found all around the British Isles and from the Faeroes to the Mediterranean.
Trusted
Ecology
Habitat
Depth range based on 38 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 81
Temperature range (°C): 7.066 - 12.270
Nitrate (umol/L): 4.820 - 8.618
Salinity (PPS): 34.990 - 35.343
Oxygen (ml/l): 6.068 - 6.213
Phosphate (umol/l): 0.373 - 0.624
Silicate (umol/l): 2.639 - 3.617
Graphical representation
Depth range (m): 0 - 81
Temperature range (°C): 7.066 - 12.270
Nitrate (umol/L): 4.820 - 8.618
Salinity (PPS): 34.990 - 35.343
Oxygen (ml/l): 6.068 - 6.213
Phosphate (umol/l): 0.373 - 0.624
Silicate (umol/l): 2.639 - 3.617
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 81
Temperature range (°C): 7.066 - 12.270
Nitrate (umol/L): 4.820 - 8.618
Salinity (PPS): 34.990 - 35.343
Oxygen (ml/l): 6.068 - 6.213
Phosphate (umol/l): 0.373 - 0.624
Silicate (umol/l): 2.639 - 3.617
Graphical representation
Depth range (m): 0 - 81
Temperature range (°C): 7.066 - 12.270
Nitrate (umol/L): 4.820 - 8.618
Salinity (PPS): 34.990 - 35.343
Oxygen (ml/l): 6.068 - 6.213
Phosphate (umol/l): 0.373 - 0.624
Silicate (umol/l): 2.639 - 3.617
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Common on the lower shore and shallow sublittoral on rocky coasts. Feeds on encrusting siliceous sponges especially Halichondria panicea and Haliclona spp.
Trusted
This animal may be found on the shore and in the shallow subtidal. It feeds on a variety of sponges, but especially on species of Haliclona including Haliclona oculata and Halclona cinerea. The spawn is a broad ribbon laid in a neat, tight coil.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Jorunna tomentosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ATTTTTGGTATATGATGTGGACTTCTTGGAACTGGATTAAGTTTATTAATTCGATTTGAATTAGGAACAGCTGGTGCATTCCTTGGTGAT---GATCACTTTTACAATGTAATTGTGACTGCACACGCTTTTGTTATAATTTTTTTTATGGTAATACCTCTAATAATTGGAGGATTTGGAAACTGAATAGTTCCTTTACTAATTGGAGCTCCTGATATGAGTTTTCCCCGTATAAATAATATGAGTTTTTGGTTATTACCTCCATCTTTTATTCTATTATTATGTTCAACCTTAATAGAAGGAGGGGCTGGGACAGGATGAACTGTTTATCCTCCCCTTTCTGGTCCAGTTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTGCTTCCTCTTTATTAGGTGCAATCAACTTTATTACTACAATTTTTAATATACGGTCTTCAGCTATATCTATAGAACGATTAAGATTATTTGTATGATCGGTTCTGGTAACAGCTTTCTTACTATTACTTTCATTACCTGTATTAGCTGGAGCTATTACAATGCTCTTAACGGATCGAAATTTTAACACTAGTTTCTTTGAT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Jorunna tomentosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Trusted
Wikipedia
Jorunna tomentosa
Jorunna tomentosa is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae. [1]
Distribution
This species occurs in European waters and in the Mediterranean Sea.
References
- ^ a b Gofas, S. (2011). Jorunna tomentosa (Cuvier, 1804). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140166 on 2011-08-23
- Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
- Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
- Camacho-Garcia Y.E. & Gosliner T.M. (2008) Systematic revision of Jorunna Bergh, 1876 (Nudibranchia: Discodorididae) with a morphological phylogenetic analysis. Journal of Molluscan Studies 74:143-181
- Dayrat B. 2010. A monographic revision of discodorid sea slugs (Gastropoda, Opisthobranchia, Nudibranchia, Doridina). Proceedings of the California Academy of Sciences, Series 4, vol. 61, suppl. I, 1-403, 382 figs.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


