Overview

Comprehensive Description

Description

 Jorunna tomentosa is usually sandy brown in colour with a loosely paired series of dark brown blotches down the sides of the body. It grows to about 6 cm in length.The mantle of Jorunna tomentosa is velvety, caused by the dense covering of small, uniform tubercles with an array of protruding spicules (caryophyllidia). Each tubercle has a characteristic retractile central projecting finger. There are up to 17 tripinnate gills, located within a gill pocket. The oral tentacles are short, slender and finger-like. The foot projects posteriorly when crawling. Jorunna tomentosa feeds on encrusting siliceous sponges, especially Halichondria panicea and Haliclona spp. Its colour and texture ensure this sea slug is well camouflaged amongst the sponges.Spawning is recorded February to August (Thompson & Brown, 1984). The spawn is a broad ribbon laid in neat, tight coil. Each spiral spawn mass contains up to 145,000 eggs (Thompson & Brown, 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

J. tomentosa is yellow to sandy brown in colour. The mantle is velvety in appearance and to the touch. This effect is created by the presence of numerous, small, uniform tubercles. Usually there are several pairs of dark brown spots on the sides of the mantle, however the variety lemchei lacks these spots. Individuals may reach a length of up to 55mm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Irish Exclusive economic Zone, Oosterschelde, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found all around the British Isles and from the Faeroes to the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 38 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 81
  Temperature range (°C): 7.066 - 12.270
  Nitrate (umol/L): 4.820 - 8.618
  Salinity (PPS): 34.990 - 35.343
  Oxygen (ml/l): 6.068 - 6.213
  Phosphate (umol/l): 0.373 - 0.624
  Silicate (umol/l): 2.639 - 3.617

Graphical representation

Depth range (m): 0 - 81

Temperature range (°C): 7.066 - 12.270

Nitrate (umol/L): 4.820 - 8.618

Salinity (PPS): 34.990 - 35.343

Oxygen (ml/l): 6.068 - 6.213

Phosphate (umol/l): 0.373 - 0.624

Silicate (umol/l): 2.639 - 3.617
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Common on the lower shore and shallow sublittoral on rocky coasts. Feeds on encrusting siliceous sponges especially Halichondria panicea and Haliclona spp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This animal may be found on the shore and in the shallow subtidal. It feeds on a variety of sponges, but especially on species of Haliclona including Haliclona oculata and Halclona cinerea. The spawn is a broad ribbon laid in a neat, tight coil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Jorunna tomentosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTTGGTATATGATGTGGACTTCTTGGAACTGGATTAAGTTTATTAATTCGATTTGAATTAGGAACAGCTGGTGCATTCCTTGGTGAT---GATCACTTTTACAATGTAATTGTGACTGCACACGCTTTTGTTATAATTTTTTTTATGGTAATACCTCTAATAATTGGAGGATTTGGAAACTGAATAGTTCCTTTACTAATTGGAGCTCCTGATATGAGTTTTCCCCGTATAAATAATATGAGTTTTTGGTTATTACCTCCATCTTTTATTCTATTATTATGTTCAACCTTAATAGAAGGAGGGGCTGGGACAGGATGAACTGTTTATCCTCCCCTTTCTGGTCCAGTTGCTCATGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTGCTTCCTCTTTATTAGGTGCAATCAACTTTATTACTACAATTTTTAATATACGGTCTTCAGCTATATCTATAGAACGATTAAGATTATTTGTATGATCGGTTCTGGTAACAGCTTTCTTACTATTACTTTCATTACCTGTATTAGCTGGAGCTATTACAATGCTCTTAACGGATCGAAATTTTAACACTAGTTTCTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Jorunna tomentosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Jorunna tomentosa

Jorunna tomentosa is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Discodorididae. [1]

Distribution

This species occurs in European waters and in the Mediterranean Sea.

References

  1. ^ a b Gofas, S. (2011). Jorunna tomentosa (Cuvier, 1804). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140166 on 2011-08-23
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
  • Camacho-Garcia Y.E. & Gosliner T.M. (2008) Systematic revision of Jorunna Bergh, 1876 (Nudibranchia: Discodorididae) with a morphological phylogenetic analysis. Journal of Molluscan Studies 74:143-181
  • Dayrat B. 2010. A monographic revision of discodorid sea slugs (Gastropoda, Opisthobranchia, Nudibranchia, Doridina). Proceedings of the California Academy of Sciences, Series 4, vol. 61, suppl. I, 1-403, 382 figs.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!