Overview

Comprehensive Description

Biology

Inhabits gravel-sand runs and rocky riffles of creeks and small to medium rivers, near vegetation (Ref. 5723, 10294). Feeds on midge larvae (Ref. 10294).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Atlantic and Gulf slope drainages from Edisto River, South Carolina, to Amite-Comite river system, Louisiana. Ranges south to upper St. Johns River system in peninsular Florida. Common.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic and Gulf Slope drainages from Edisto River in South Carolina, USA to Amite-Comite River in Louisiana, USA; south in peninsular Florida to St. John's River drainage.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern U.S.A.: Atlantic and Gulf of Mexico draining rivers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 94 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.4 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 3 years (Ref. 12193)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Creeks and small to medium rivers, usually in moderate current in sand-gravel runs and rocky riffles, near vegetation (Page and Burr 1991).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 0.505 - 0.505
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Noturus leptacanthus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAGTATTTGGAGCCTGAGCCGGAATGGTTGGTACTGCCCTTAGCCTACTTATCCGAGCAGAACTAGCCCAACCCGGAGCCCTTTTGGGCGATGATCAACTTTATAATGTTGTTGTAACCGCTCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCAGTAATAATTGGAGGATTTGGTAACTGACTCGTACCCCTTATGATTGGTGCCCCTGATATAGCCTTTCCTCGAATAAACAACATAAGTTTTTGACTACTCCCCCCATCTTTCCTCCTGCTCCTTGCCTCCTCAGGTGTTGAAGCAGGTGCCGGAACCGGCTGAACCGTGTACCCTCCCCTTGCCGGAGGCCTTGCTCACGCAGGGGCCTCAGTAGACTTAACTATCTTCTCCCTCCACCTCGCAGGAGTTTCATCAATTCTAGGGGCTATCAATTTTATTACAACCATTATTAATATAAAACCCCCTGCAATTTCACAATACCAAACACCTTTATTTGTTTGAGCTGTTCTAATTACAGCTGTTCTTTTACTATTATCCCTCCCAGTTTTAGCCGCCGGCATCACAATACTTCTAACAGACCGAAATCTAAATACTACATTCTTTGACCCTGCAGGAGGAGGAGACCCCATCCTCTATCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Noturus leptacanthus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Noturus leptacanthus

The Speckled Madtom (Noturus leptacanthus) is one of the 324 fish species found in Tennessee.

Introduction[edit]

The speckled madtom (Noturus leptacanthus) is a North American fish that belongs to the Noturus genus of the Ictaluridae family. It is characterized by being a dark reddish brown color with a dusky or mottled caudal fin with a pale border, and also by the toxic sting from the pelvic and pectoral fins associated with the genus Noturus.[1]The average size of this fish is between 39 and 50mm; however, the longest ever recorded specimen was 110mm. The average life span is 2.5 to 3 years. Because of having such a short life, they become mature by their second summer. Their diet consists mostly of midge larvae. The speckled madtom is found in the Southeastern United States from Tennessee to Florida and the states in between including South Carolina, Georgia, Alabama, and Mississippi. They tend to thrive in small to medium-sized moderately swift moving streams over gravel or boulder riffle. The study done in 1978 by Clark indicated that they spawn during the early summer in discarded cans or bottles that are free of debris due to the nest preparation activities of the males. Specialized management is not required for this species, which is why it has such a healthy population across its range. [2]

Geographic Distribution of Species[edit]

The speckled madtom has a wide range throughout the southeastern United States. In Tennessee it is found only in the Canasauga River system, where it is abundant.[3]It is also found in Atlantic and Gulf slope drainages from the Edisto River in South Carolina to the Amite-Comite River system of Louisiana. The St. Johns River system in the Florida peninsula makes up the southernmost area of their range.[4] In total they are found in abundant numbers throughout Louisiana, Mississippi, Alabama, Georgia, Florida, South Carolina and Tennessee.[5] The natural distribution of this species has not declined much, if any.

Ecology[edit]

The speckled madtom inhabits small to moderate sized streams and is normally a creek species. They often inhabit very shallow riffles with sand, rock or gravel bottoms. During the day speckled madtoms will rest in areas with aquatic vegetation such as pondweed or bur-weed.[6] However, due to their nocturnal feeding patterns, they will leave these areas at night to go feed. Feeding begins at dusk and the amount of food in their stomach will increase until dawn when the feeding stops. Their diet is mostly insect larvae, especially midge larvae.[3] They detect their food with their sensory barbels, and their vision undoubtedly plays little part in their feeding behavior. Major competition for the speckled madtom comes from other species from the Noturus genus. The only known predators of the speckled madtom are the rock bass, Ambloplites rupestris, and larger Noturus species.[7] In order to protect themselves from predation, all Noturus species have developed a venomous sting from their pectoral spines. The level of toxicity varies among each species and it was found that the speckled madtom did not have a high level of toxicity.[8] Human influences such as pollution that would kill aquatic vegetation would be detrimental to the population of this species.

Life History[edit]

The spawning period for the speckled madtom is from May through August with water temperatures ranging from 20-24°C. The speckled madtom is one of the least fecund species of freshwater North American fishes. They normally spawn two clutches per year with each clutch consisting of 14-45 eggs. Their eggs are very large relative to their body size, with the average size being 5.5mm in diameter. It is believed that the large egg size compensates for the extremely small clutch size. The large egg size allows for the larvae to be very large and well developed upon hatching.[7] The average size of 1 year old is 39mm, and the average size of a 2 year old is 50mm. They reach sexual maturity by their second summer and have a maximum lifespan of just over 2 years. The speckled madtom is known to nest inside of discarded cans and bottles that are cleared of debris and silt by the male. The male then guards the eggs without feeding for around 2.5 weeks.[6] This species is very unique in that pollution of cans and bottles actually provides more nesting opportunity, which could increase the populations.

Current Management[edit]

Currently, there is no widespread management in effect for the speckled madtom. The population of this species is steady throughout its range and shows no signs of major decline. While there may be localized threats to this species, there is no widespread threat that is known.[4]Localized threats could include things such as habitat destruction, which takes place everywhere on some scale. It is not known as a sport fish, so overfishing is not an issue. However, it has been noted that many fisherman like to use this species as bait. Also, hybridization has not been found to be an issue due to the unique spawning patterns and habits of the speckled madtom.[7] Due to their toxic and sharp spines, over predation is not a huge issue for this species either. The largest threat for this species would be habitat destruction or loss of flow in streams. In order to make sure this population stays at a healthy size, we must make sure we don’t destroy loads of habitat and/or use our water resources irresponsibly. Also, it was shown in the Chattahoochee River system that agricultural land use increases the number of speckled madtoms in the streams. Agriculture has been known to hurt many species because of runoff, but the speckled madtom is more abundant in areas with agricultural land use.[9] There are no agencies or non-governmental groups that are actively protecting this species, so the management and protection of this species will largely be the responsibility of individual people and the decisions they make.

Management Recommendations[edit]

In order to manage this species, it would be necessary to have a good idea of how many fish there are in different areas of its range. I would start by taking samples from multiple streams in each watershed. I would conduct these samples by using seines in shallow riffle areas with dense aquatic vegetation. This method would be used during the day and anytime between late August and late June. I would not want to do this during the mating season due to the fact that the males not readily leave the nest, and it really isn’t known how they respond after being taken from their nest.[10] Also, at night I would use different types of traps to try to trap these fish while they are foraging for food. Once there was a definitive result on the number of these fish in each watershed, we could determine the areas that need management. One of the best ways to manage this species is to increase aquatic vegetation that they rely on for foraging and protection from the few predators they have.[7] The only area I would consider setting aside as a protected watershed would be the Conasauga River system in Tennessee. The reason is because this is the only area where this species is found in Tennessee, and it is much more common in every other state within its range.[3]

References[edit]

  1. ^ Williams, James D., National Audubon Society Field Guide to Fishes. 2nd ed. New York: Alfred A. Knopf, 2011. 181. Print.
  2. ^ Clark, K. E., Reproduction of the Speckled Madtom, Noturus leptacanthus. Journal of the Mississippi Academy of Sciences 22 (1977). 108pp.
  3. ^ a b c Etnier, David A., and Wayne C. Starnes., The Fishes of Tennessee. Knoxville, Tennessee: The University of Tennessee Press, 2001. 321-22. Web. 20 Nov. 2013.
  4. ^ a b Noturus leptacanthus. Encyclopedia of Life, n.d. Web. 21 Nov. 2013. [1].
  5. ^ Speckled Madtom. Florida Museum of Natural History, n.d. Web. 21 Nov. 2013. [2].
  6. ^ a b Ross, Stephen T., Inland Fishes of Mississippi. Jackson, Mississippi: Mississippi Department of Wildlife, Fisheries, and Parks, 2001. 323-24. Web. 20 Nov. 2013.
  7. ^ a b c d Clark, Kathleen E., Ecology and Life History of the Speckled Madtom, Noturus leptacanthus [Ictaluridae]. 1978
  8. ^ Reed, Hugh D., The Poison Glands of Notorus and Schilbeodes. The American Naturalist 41(1907): 553-566.
  9. ^ Walser, C A., H. L. Bart., Influence of Agriculture on In-Stream Habitat and Fish Community Structure in Piedmont Watersheds of the Chattahoochee River System. Ecology of Freshwater Fish 8.4 (1999): 237-246
  10. ^ Bulger, Angela G., Edds, David R., Population Structure and Habitat Use in Neosho Madtom (Noturus placidus). The Southwestern Naturalist 46 (2001): 8-15
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!