Articles on this page are available in 1 other language: Arabic (14) (learn more)

Overview

Comprehensive Description

Biology

A secretive species remaining in or near interstices of rock, coral, or rubble (Ref. 2334, 58302). Moderately common in seaward reefs in areas exposed to moderate surge or currents (Ref. 2334). Benthic (Ref. 58302). Minimum depth reported from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Mangaréva, Tuamoto Islands and the Hawaiian Islands, north to Taiwan; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Aldabra, Madagascar and western Mascarenes east to Hawaiian Islands and Pitcairn Group, north to Taiwan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 85 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.5 cm SL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Irregular dark bars on body which may be broken into spots; 2 narrow diagonal bars on cheek; opercle and base of soft dorsal with large ocellated black spot (Ref. 5469).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Amblycirrhitus bimacula
Catalog Number: USNM 50702
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1889
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 20 m (Ref. 9710), usually 2 - 15 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 108 specimens in 1 taxon.
Water temperature and chemistry ranges based on 77 samples.

Environmental ranges
  Depth range (m): 0.8 - 35
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.019 - 0.498
  Salinity (PPS): 33.532 - 36.148
  Oxygen (ml/l): 4.454 - 5.032
  Phosphate (umol/l): 0.085 - 0.301
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.8 - 35

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.019 - 0.498

Salinity (PPS): 33.532 - 36.148

Oxygen (ml/l): 4.454 - 5.032

Phosphate (umol/l): 0.085 - 0.301

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated. Twospot hawkfish .  (Jenkins, 1903) Attains 8 cm. About 10 slightly irregular dark bars on body (sometimes broken into spots) and two diagonal bars on cheek; a large ocellated black spot on opercle and another at the base of the soft dorsal fin. Found on coral reefs or rocky bottoms. Ranges from Indo-Pacific south to East London in South Africa.  Seen at Antons by Dennis King 15/08/98
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblycirrhitus bimacula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNTTTACTGAGTATTCGGTGCTTGAGCTGGAATGGTTGGAACAGCTCTTAGCCTGCTAATTCGGGCGGAACTAAGCCAACCAGGCGCCCTCCTGGGCGATGACCAGATCTACAATGTTATCGTTACTGCACATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTCGGAAACTGACTTATCCCCTTAATAATCGGAGCCCCAGACATGGCCTTCCCACGAATAAACAACATAAGCTTTTGACTCCTTCCTCCCTCATTCCTTCTACTTTTAGCATCTTCTGGCATTGAAGCCGGGGCAGGAACAGGCTGAACAGTATATCCTCCCCTAGCCGGAAATCTGGCACATGCAGGAGCATCCGTTGACTTAACTATCTTTTCTCTACACTTAGCAGGTATTTCCTCTATTCTGGGGGCAATCAATTTCATCACAACTATTATTAACATGAAGCCCCCTGCTATCTCCCAATACCAAACCCCTCTATTCGTCTGAGCAGTACTCATTACTGCAGTATTACTTCTTCTATCCCTTCCTGTCCTTGCTGCCGGTATTACAATGCTCCTTACAGACCGTAATTTAAACACCACCTTCTTCGACCCCGCAGGAGGTGGAGACCCCATTCTCTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amblycirrhitus bimacula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!