Articles on this page are available in 1 other language: Arabic (14) (learn more)
Overview
Comprehensive Description
Biology
A secretive species remaining in or near interstices of rock, coral, or rubble (Ref. 2334, 58302). Moderately common in seaward reefs in areas exposed to moderate surge or currents (Ref. 2334). Benthic (Ref. 58302). Minimum depth reported from Ref. 30874.
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Distribution
Indo-Pacific: East Africa to Mangaréva, Tuamoto Islands and the Hawaiian Islands, north to Taiwan; throughout Micronesia.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Mozambique, Seychelles, South Africa (country)
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Indo-West Pacific: East Africa, South Africa, Aldabra, Madagascar and western Mascarenes east to Hawaiian Islands and Pitcairn Group, north to Taiwan.
Trusted
Physical Description
Morphology
Dorsal spines (total): 10; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 6
-
Randall, J.E. 1986 Cirrhitidae. p. 664-666. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5469)
http://www.fishbase.org/references/FBRefSummary.php?id=5469&speccode=5829
Trusted
Size
Max. size
8.5 cm SL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Diagnostic Description
Irregular dark bars on body which may be broken into spots; 2 narrow diagonal bars on cheek; opercle and base of soft dorsal with large ocellated black spot (Ref. 5469).
-
Randall, J.E. 1986 Cirrhitidae. p. 664-666. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 5469)
http://www.fishbase.org/references/FBRefSummary.php?id=5469&speccode=5829
Trusted
Type Information
Type for Amblycirrhitus bimacula
Catalog Number: USNM 50702
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1889
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
Catalog Number: USNM 50702
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): O. Jenkins
Year Collected: 1889
Locality: Honolulu, Oahu, Hawaii, United States, Hawaiian Islands, Pacific
- Type:
Trusted
Ecology
Habitat
Environment
reef-associated; non-migratory; marine; depth range 0 - 20 m (Ref. 9710), usually 2 - 15 m (Ref. 37816)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
-
Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
http://www.fishbase.org/references/FBRefSummary.php?id=37816&speccode=4307
Trusted
Depth range based on 108 specimens in 1 taxon.
Water temperature and chemistry ranges based on 77 samples.
Environmental ranges
Depth range (m): 0.8 - 35
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 0.498
Salinity (PPS): 33.532 - 36.148
Oxygen (ml/l): 4.454 - 5.032
Phosphate (umol/l): 0.085 - 0.301
Silicate (umol/l): 0.897 - 4.892
Graphical representation
Depth range (m): 0.8 - 35
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 0.498
Salinity (PPS): 33.532 - 36.148
Oxygen (ml/l): 4.454 - 5.032
Phosphate (umol/l): 0.085 - 0.301
Silicate (umol/l): 0.897 - 4.892
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 77 samples.
Environmental ranges
Depth range (m): 0.8 - 35
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 0.498
Salinity (PPS): 33.532 - 36.148
Oxygen (ml/l): 4.454 - 5.032
Phosphate (umol/l): 0.085 - 0.301
Silicate (umol/l): 0.897 - 4.892
Graphical representation
Depth range (m): 0.8 - 35
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 0.498
Salinity (PPS): 33.532 - 36.148
Oxygen (ml/l): 4.454 - 5.032
Phosphate (umol/l): 0.085 - 0.301
Silicate (umol/l): 0.897 - 4.892
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 20m.
Recorded at 20 meters.
Habitat: reef-associated. Twospot hawkfish . (Jenkins, 1903) Attains 8 cm. About 10 slightly irregular dark bars on body (sometimes broken into spots) and two diagonal bars on cheek; a large ocellated black spot on opercle and another at the base of the soft dorsal fin. Found on coral reefs or rocky bottoms. Ranges from Indo-Pacific south to East London in South Africa. Seen at Antons by Dennis King 15/08/98
Recorded at 20 meters.
Habitat: reef-associated. Twospot hawkfish . (Jenkins, 1903) Attains 8 cm. About 10 slightly irregular dark bars on body (sometimes broken into spots) and two diagonal bars on cheek; a large ocellated black spot on opercle and another at the base of the soft dorsal fin. Found on coral reefs or rocky bottoms. Ranges from Indo-Pacific south to East London in South Africa. Seen at Antons by Dennis King 15/08/98
Trusted
Trophic Strategy
Occurs inshore (Ref. 75154).
-
Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
http://www.fishbase.org/references/FBRefSummary.php?id=58534&speccode=7294
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Amblycirrhitus bimacula
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
NNNNNTTTACTGAGTATTCGGTGCTTGAGCTGGAATGGTTGGAACAGCTCTTAGCCTGCTAATTCGGGCGGAACTAAGCCAACCAGGCGCCCTCCTGGGCGATGACCAGATCTACAATGTTATCGTTACTGCACATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTCGGAAACTGACTTATCCCCTTAATAATCGGAGCCCCAGACATGGCCTTCCCACGAATAAACAACATAAGCTTTTGACTCCTTCCTCCCTCATTCCTTCTACTTTTAGCATCTTCTGGCATTGAAGCCGGGGCAGGAACAGGCTGAACAGTATATCCTCCCCTAGCCGGAAATCTGGCACATGCAGGAGCATCCGTTGACTTAACTATCTTTTCTCTACACTTAGCAGGTATTTCCTCTATTCTGGGGGCAATCAATTTCATCACAACTATTATTAACATGAAGCCCCCTGCTATCTCCCAATACCAAACCCCTCTATTCGTCTGAGCAGTACTCATTACTGCAGTATTACTTCTTCTATCCCTTCCTGTCCTTGCTGCCGGTATTACAATGCTCCTTACAGACCGTAATTTAAACACCACCTTCTTCGACCCCGCAGGAGGTGGAGACCCCATTCTCTACCAACATCT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Amblycirrhitus bimacula
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
aquarium: commercial
-
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


