Overview

Comprehensive Description

Biology

Found on the continental slopes. Poorly known. Oviparous, probably one egg per oviduct laid at a time. Not utilized at present.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Philippines, South and East China seas; northward to the Suruga Bay, Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The species occurs in the Indo-West Pacific from Malaysia and Borneo north to Suruga Bay, Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 244))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnostic features include the very short abdomen, with interspace between pectoral and pelvic fins base shorter than 3/5 of anal fin base length; pectoral fin tip reaching beyond the midpoint between pectoral and pelvic fins; first dorsal fin smaller in area than the second dorsal; posterior end base (axil) of second dorsal clearly in front of anal fin axil; low anal fin with a long base. Egg capsule very slender; without tendrils, conical posterior end. Claspers without hooks, with posterior margin of exorhipidion forming a free lobe (Ref. 37959). Black, brown or grey (Ref. 11146), without conspicuous markings on fins (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Apristurus platyrhynchus
Catalog Number: USNM 93135
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1909
Locality: Sipadan Id., Vic. Sibuko B. Borneo, Indonesia, Pacific
Vessel: Albatross
  • Type: Fowler, H. W. 1934. Proceedings of the Academy of Natural Sciences of Philadelphia. 85: 237, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 759 - ? m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A. platyrhynchus is a poorly known, continental slope species. Maximum size was estimated by Nakaya and Sato (2000) to be about 85 cm TL. Both sexes mature around 60 cm TL. Reproduction is oviparous with one egg per oviduct laid at a time. Egg cases are long, slender and cylindrical (9.4 cm long x 2.2 cm wide). The surface of the egg case is smooth, the anterior end lacks processes and is composed of weak fibrous tissue. The posterior end comes to a single point and lacks tendrils (Nakaya and Sato 2000). The construction of the egg cases and absence of tendrils suggests the eggs may be retained in the female and develop in-utero. This appears to be unique among the Apristurus species, however, the egg cases and development of many have yet to be described.

Apristurus species are relatively small, sluggish sharks that live on or near the bottom. Diet includes crustaceans (penaeid shrimps, euphausiids), squids and small fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 315 - 759

Graphical representation

Depth range (m): 315 - 759
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apristurus platyrhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGAATAGTTGGAATGGCTTTAAGCTTATTAATTCGTGCTGAACTAGGTCAACCCGGATCTCTTTTGGGAGATGATCAGATTTACAATGTGATCGTTACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTTATACCAGTAATAATTGGTGGCTTTGGTAATTGACTTGTTCCTTTGATAATTGGTGCGCCAGACATAGCGTTCCCGCGTATAAATAATATAAGCTTCTGACTCCTCCCCCCCTCTTTCTTACTTCTCTTGGCTTCTGCAGGGGTTGAAGCGGGAGCAGGAACCGGGTGAACTGTTTATCCCCCCCTAGCTGGTAACTTAGCACACGCTGGGCCATCCGTTGACCTAGCTATCTTTTCCCTCCATCTGGCCGGTGTTTCATCTATTTTGGCCTCAATTAATTTTATTACAACCATTATTAATATAAAACCCCCAGCCATTTCCCAATATCAAACGCCCCTATTTGTTTGGTCAATTCTTATTACCACTGTTCTTCTTCTTCTCTCTCTCCCAGTTCTTGCAGCCGGAATTACAATATTACTTACAGACCGCAACCTTAATACAACATTTTTTGACCCTGCTGGAGGGGGGGACCCCATTCTCTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apristurus platyrhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Duffy, C. & Huveneers, C.

Reviewer/s
Kyne, P.M., Cavanagh, R.D. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
Apristurus platyrhynchus is a poorly known, Indo-West Pacific continental slope deepwater catshark. Maximum size is estimated to be about 85 cm total length (TL). Probably taken as bycatch in deepwater trawl, set net and line fisheries throughout its range. However, at present there is insufficient information available to assess the species beyond Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Probably taken as bycatch in deepwater trawl, set net and line fisheries throughout its range. Other species of deepwater Chondrichthyans are known to be captured as bycatch in deepwater fisheries. As these fisheries expand globally, consideration needs to be given to the fact that this species too may be captured incidentally in deepwater fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No conservation actions are currently in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spatulasnout catshark

The spatulasnout cat shark, Apristurus platyrhynchus, is a cat shark of the family Scyliorhinidae found in the western Pacific between latitudes 35° N and 1° N. Its length is up to 80 cm.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Flatnose cat shark

The flatnose cat shark, Apristurus acanutus, is a cat shark of the family Scyliorhinidae found in the northwest Pacific Ocean off Zhujiang, South China Sea. This species is now considered a junior synonym of A. platyrhynchus.

See also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!