Overview

Comprehensive Description

Biology

Commonly found in weedy areas and especially around reefs, where they usually swim snout-down among sea whips (gorgonians). A solitary ambusher of small fishes and crustaceans that lurk among branching coral or gorgonians. Often swims behind large herbivorous fishes to sneak up on prey. Mouth opens to diameter of body to suck in prey (Ref. 9710). Marketed locally. Has been traded as an aquarium fish at Ceará, Brazil (Ref. 49392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: southern Florida, USA and Bermuda to northern South America. East to St. Paul's Rocks (Ref. 13121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 21 - 25; Analsoft rays: 21 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Prominent barbel at tip of lower jaw. Dorsal fin preceded by 8-13 well-spaced, isolated spines (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 25 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 40 specimens in 1 taxon.
Water temperature and chemistry ranges based on 32 samples.

Environmental ranges
  Depth range (m): 0.5 - 350
  Temperature range (°C): 17.552 - 27.684
  Nitrate (umol/L): 0.122 - 5.051
  Salinity (PPS): 34.217 - 36.618
  Oxygen (ml/l): 4.454 - 5.147
  Phosphate (umol/l): 0.006 - 0.344
  Silicate (umol/l): 0.799 - 3.653

Graphical representation

Depth range (m): 0.5 - 350

Temperature range (°C): 17.552 - 27.684

Nitrate (umol/L): 0.122 - 5.051

Salinity (PPS): 34.217 - 36.618

Oxygen (ml/l): 4.454 - 5.147

Phosphate (umol/l): 0.006 - 0.344

Silicate (umol/l): 0.799 - 3.653
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 25m.
From 2 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Commonly found in weedy areas and especially around reefs, where they usually swim snout-down among sea whips (gorgonians). A solitary ambusher of small fishes and crustaceans that lurk among branching coral or gorgonians. Often swims behind large herbivorous fishes to sneak up on prey. Mouth opens to diameter of body to suck in prey (Ref. 9710). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aulostomus maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTTTACCTAATCTTCGGGGCATGAGCCGCGATAGTAGGAACCGCCCTTAGTCTTATCATCCGGGCCGAGCTTAGCCAACCGGGGGGTCTCCTGGGTAACGATCAACTTTACAATGTTGTTGTAACAGCCCACGCCTTCGTTATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGAAATTGATTAATTCCCTTAATGATCGGARCCCCCGACATGGCCTTCCCCCGAATAAATAACATGAGCTTCTGGCTCCTGCCCCCCTCCTTCCTCCTCCTCTTAACCTCCTCTGCGGTAGAGGCCGGGTCCGGGACCGGATGGACGGTTTACCCGCCCCTGGCTGGGAACCTGGCCCACGCCGGAGCGTCCGTAGACCTGACCATCTTCTCGCTTCACCTCGCCGGAATTTCCTCCATCCTAGGAGCAATTWAYTTTATTACAACCATTATTAATATAAAACCCCCTGCCACCTCCCCATACCAGCTCCCCCTGTTCGTATGAGCTGTCCTGGTTACTGCTGTGCTTCTCCTCCTTTCTCTCCCAGTCCTAGCAGCTGGCATTACAATGCTGTTAACTGACCGAAACCTGAACACCACCTTCTTCGACCCTGCAGGGGGAGGCGATCCTATTCTATATCAACACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aulostomus maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trumpetfish

For the trumpetfish family, see Aulostomidae.

The trumpetfish, Aulostomus maculatus, is a long-bodied fish with an upturned mouth; it often swims vertically while trying to blend with vertical coral, such as sea rods, sea pens, and pipe sponges.

Distribution[edit]

It is widespread throughout the tropical waters of western Atlantic Ocean from Florida to Brazil including the Caribbean Sea and the Gulf of Mexico.[1]

Habitat[edit]

Trumpetfish occur in waters between 0.5 and 30 meters (1.6 and 100 feet) deep, and can grow to 40 to 80 cm (15 to 31 in) in length. They are sometimes locally abundant over coral atoll reefs or in lagoons, where they may be caught even in areas of severe wave action. The spawning habits of the trumpetfish are unknown, but in the region around Madeira, the females are known to have mature eggs from March to June.

Description[edit]

A brown trumpetfish

Trumpetfish are closely related to cornetfish. Trumpetfish can be a bit more than 36 inches (3 ft) long and have greatly elongated bodies with small jaws at the front end of their long, tubular snouts. The gills are pectinate, resembling the teeth of a comb, and a soft dorsal fin is found near the tail fin. A series of spines occurs in front of the dorsal fin. Trumpetfish vary in color from dark brown to greenish, but also yellow in some areas. A black streak, sometimes reduced to a dark spot, occurs along the jaw, and a pair of dark spots is sometimes found on the base of the tail fin.

Trumpetfish swim slowly, sneaking up on unsuspecting prey, or lying motionless like a floating stick, swaying back and forth with the wave action of the water. They are adept at camouflaging themselves and often swim in alignment with other, larger fishes. They feed almost exclusively on small fish, such as wrasses and Atheriniformes, by sucking them suddenly into their small mouths.

Trumpetfish at Molasses Reef, Florida Keys
Cornetfish (a close relative often mistaken for a trumpetfish) in Kona, Hawaii. The key visible difference is the tail: pointed "T" in a cornetfish and rounded, fan-shaped in a trumpetfish

References[edit]

  1. ^ http://eol.org/pages/585434/details#distribution
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!