Overview

Comprehensive Description

Oligosarcus jenynsii ,

MZUSP 42370 , 2(c&s), Argentina , Buenos Aires , Laguna dos Lobos .

  • Alexandre C. Ribeiro, Marcel R. Cavallaro, Otávio Froehlich (2007): Oligosarcus perdido (Characiformes, Characidae), a new species of freshwater fish from Serra da Bodoquena, upper Rio Paraguai basin, Brazil. Zootaxa 1560, 43-53: 52-52, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:3779DDFF-75D8-49AF-96C8-18942ED78EE2
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs in ponds. Feeds on fish (Ref. 79585).
  • Lima, F.C.T., L.R. Malabarba, P.A. Buckup, J.F. Pezzi da Silva, R.P. Vari, A. Harold, R. Benine, O.T. Oyakawa, C.S. Pavanelli, N.A. Menezes, C.A.S. Lucena, M.C.S.L. Malabarba, Z.M.S. Lucena, R.E. Reis, F. Langeani, C. Moreira et al. … 2003 Genera Incertae Sedis in Characidae. p. 106-168. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38376)   http://www.fishbase.org/references/FBRefSummary.php?id=38376&speccode=10622 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Streams, rivers and lagoons of coatal areas and interior plains of Rio Grande do Sul state and Paraná River basin: Argentina, Brazil and Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South America: streams, rivers and lagoons of coastal areas and interior plains of Rio Grande do Sul (Brazil), Uruguay and Argentina.
  • Lima, F.C.T., L.R. Malabarba, P.A. Buckup, J.F. Pezzi da Silva, R.P. Vari, A. Harold, R. Benine, O.T. Oyakawa, C.S. Pavanelli, N.A. Menezes, C.A.S. Lucena, M.C.S.L. Malabarba, Z.M.S. Lucena, R.E. Reis, F. Langeani, C. Moreira et al. … 2003 Genera Incertae Sedis in Characidae. p. 106-168. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38376)   http://www.fishbase.org/references/FBRefSummary.php?id=38376&speccode=10622 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

31.0 cm TL (male/unsexed; (Ref. 79585)); max. published weight: 330 g (Ref. 79585)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

MZUSP 42370 , 2(c&s), Argentina , Buenos Aires , Laguna dos Lobos .

License not applicable

Alexandre C. Ribeiro

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Oligosarcus jenynsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Oligosarcus jenynsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCTGGGATAGTTGGAACTGCTCTAAGCCTTTTAATTCGGGCAGAGCTCGGCCAACCAGGATCCCTTCTAGGCGATGACCAGGTATACAATGTTCTGGTAACCGCACATGCTTTTGTAATAATCTTTTTTATAGTCATGCCTGTAATAATTGGAGGCTTTGGAAATTGGCTTGTTCCACTTATAATTGGTGCCCCAGACATGGCCTTCCCTCGAATGAACAACATGAGTTTCTGACTTCTTCCCCCATCTTTCCTTCTCCTTTTAGCATCATCTGGAGTAGAAGCCGGAGCAGGAACAGGTTGAACTGTATACCCCCCTCTTGCTGGGAACCTTGCTCACGCAGGAGCTTCTGTAGATCTGACAATCTTTTCACTTCACCTGGCTGGAGTCTCCTCAATCTTAGGGGCAATCAATTTCATTACAACCATTATTAACATGAAACCCCCAGCTATTTCACAATACCAAACACCTCTGTTTGTTTGGGCTGTTCTAATTACAGCTGTTCTCCTGCTTCTTTCACTTCCCGTTCTAGCAGCTGGCATTACTATACTTCTTACAGACCGCAACCTTAACACTTCATTTTTTGATCCTGCAGGGGGCGGAGACCCCATTCTTTATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!