Overview

Comprehensive Description

Oligosarcus jenynsii ,

MZUSP 42370 , 2(c&s), Argentina , Buenos Aires , Laguna dos Lobos .

  • Alexandre C. Ribeiro, Marcel R. Cavallaro, Otávio Froehlich (2007): Oligosarcus perdido (Characiformes, Characidae), a new species of freshwater fish from Serra da Bodoquena, upper Rio Paraguai basin, Brazil. Zootaxa 1560, 43-53: 52-52, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:3779DDFF-75D8-49AF-96C8-18942ED78EE2
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occurs in ponds. Feeds on fish (Ref. 79585).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Streams, rivers and lagoons of coatal areas and interior plains of Rio Grande do Sul state and Paraná River basin: Argentina, Brazil and Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South America: streams, rivers and lagoons of coastal areas and interior plains of Rio Grande do Sul (Brazil), Uruguay and Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

31.0 cm TL (male/unsexed; (Ref. 79585)); max. published weight: 330 g (Ref. 79585)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

MZUSP 42370 , 2(c&s), Argentina , Buenos Aires , Laguna dos Lobos .

License not applicable

Alexandre C. Ribeiro

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oligosarcus jenynsii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCTGGGATAGTTGGAACTGCTCTAAGCCTTTTAATTCGGGCAGAGCTCGGCCAACCAGGATCCCTTCTAGGCGATGACCAGGTATACAATGTTCTGGTAACCGCACATGCTTTTGTAATAATCTTTTTTATAGTCATGCCTGTAATAATTGGAGGCTTTGGAAATTGGCTTGTTCCACTTATAATTGGTGCCCCAGACATGGCCTTCCCTCGAATGAACAACATGAGTTTCTGACTTCTTCCCCCATCTTTCCTTCTCCTTTTAGCATCATCTGGAGTAGAAGCCGGAGCAGGAACAGGTTGAACTGTATACCCCCCTCTTGCTGGGAACCTTGCTCACGCAGGAGCTTCTGTAGATCTGACAATCTTTTCACTTCACCTGGCTGGAGTCTCCTCAATCTTAGGGGCAATCAATTTCATTACAACCATTATTAACATGAAACCCCCAGCTATTTCACAATACCAAACACCTCTGTTTGTTTGGGCTGTTCTAATTACAGCTGTTCTCCTGCTTCTTTCACTTCCCGTTCTAGCAGCTGGCATTACTATACTTCTTACAGACCGCAACCTTAACACTTCATTTTTTGATCCTGCAGGGGGCGGAGACCCCATTCTTTATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oligosarcus jenynsii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!