Overview

Comprehensive Description

Biology

Adults inhabit sluggish pools and backwaters of large rivers, swamps, bayous, and lakes. Rarely enter brackish and marine waters (Ref. 5723). Feed on blue crabs, turtles, waterfowl or other birds and small mammals (Ref. 10294). Giant of the gars (Ref. 5723). Marketed fresh (Ref. 37032).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Historical range included the Mississippi River basin from southwestern Ohio (Trautman 1981), southern Indiana, and southern Illinois (Smith 1979) to the Gulf of Mexico; also the Gulf Coastal Plain from the Florida panhandle (Gilbert 1992) to Veracruz, Mexico, with disjunct occurrences in Nicaragua and northwestern Costa Rica (Wiley 1976, Lee et al. 1980). Now the species is extirpated or very rare in most of the northern part of the range north of the Gulf Coastal Plain. A single 1.5-m-long individual has been reported from the Sacramento-San Joaquin Delta, California; this introduction was attributed to release by an aquarium hobbyist (Raquel 1992). No other non-native occurrences in the United States are known (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: ranges from Mississippi River basin from southwestern Ohio and southern Illinois in USA south to Gulf of Mexico; Gulf of Mexico Coastal Plain from Enconfina River in Florida, USA to Veracruz, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Atractosteus spatula is found in the Ohio River in southwestern Ohio and the Mississippi river south to the Gulf of Mexico. They are found in drainages throughout the southeastern coastal United States (Alligator Gar, 2005). They are found in parts of Florida, Georgia, Alabama, Tennessee, Arkansas, Oklahoma, and Texas (Knopf, 2002; Shultz, 2004). Their range is from 44° to 20° north latitude and 101° to 82° west longitude (Agbayani, 2005).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Alligator gar are grayish green to brown color on their dorsal surface and yellowish or white colored ventrally (Page and Burr, 1991). They may also have brownish spots on their dorsal surface. They are alligator-like in appearance, with their long, slender body, jaws armed with many teeth, and their habit of floating at the water surface (Goddard 2005). Their eyes are small. They have a heterocercal tail. Their swim bladder can function as a lung. The snout is short and broad with two rows of teeth on the upper jaw (Etnier 1993, Knopf, 2002). They are protected by a thick set of ganoid scales (Knopf 2002). This species is the largest of the gars and one of the largest freshwater fishes in North America, growing to nearly 3 meters long and up to 137 kg. Lateral line scales number 58 to 62 (Etnier, 1993).

Range mass: 137 (high) kg.

Range length: 3 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 305 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 3050 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

305 cm OT (male/unsexed; (Ref. 3221)); max. published weight: 137.0 kg (Ref. 58490)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Large size and broad, short snout. Light dorsal stripe. Dark olivaceous brown above and white to yellowish beneath. Dark brown blotches on all fins (Ref. 37032).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Atractosteus spatula
Catalog Number: USNM 1003
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Couch
Locality: Matamora, Mexico.(Tamaulipas), North America
  • Type: Girard, C. F. 1858. Reports of explorations and surveys, to ascertain the most practicable and economical route for a railroad from the Mississippi River to the Pacific Ocean. 10: 353.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes sluggish pools of large rivers and their bayous, oxbow lakes, swamps, and backwaters, rarely brackish or marine waters along the coast (Page and Burr 2011). Spawning occurs over vegetation in warm shallow water (e.g., see Garcia de Leon et al. 2001). Spawning may occur in an impoundment (Lake Texoma) in Oklahoma (Boschung and Mayden 2004, Miller and Robison 2004). Young may float at the surface among twigs and leaves (Boschung and Mayden 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; brackish; depth range 0 - ? m (Ref. 55223)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alligator gar are found in large lakes, rivers, and bayous. Typically they are found in backwaters and bottomland swamps. They are found in both freshwater and brackish waters, they rarely enter marine waters (Etnier, 1993; Knopf, 2002).

Range depth: 0-1 (low) m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Other Habitat Features: estuarine

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennessee. Knoxville, TN: University OF Tennessee Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mostly fishes and crabs and occasionally other small vertebrates (e.g., see Seidensticker 1987, Garcia de Leon et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Alligator gars are opportunistic carnivores and sit-and-wait predators. They appear to be sluggish, but can ambush prey with short bursts of speed (Goddard, 2005). They feed on almost anything, including fish, ducks, turtles, small mammals, and carrion (Schultz, 2004).

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Alligator gars are generalist predators and eat anything they can find. They are especially important as top predators in aquatic systems (Goddard, 2005).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Alligator gars have few predators. They may be eaten by larger fish as eggs, fry, and juveniles . Because of their large size, their only natural predators as adults are American alligators (Alligator mississippiensis). Humans also prey on adult alligator gars.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: The number of extant, distinct occurrences is unknown but probably is at least a few dozen. Lee et al. (1980) mapped approximately 90 locality records in the United States, but existing evidence indicates that most of those in the northern part of the range are not represented by extant populations (see trend comments). Robison and Buchanan (1988) mapped 17 sites in Arkansas for the period 1960-1987. Mettee et al. (1996) and Boschung and Mayden (2004) mapped 12 sites in Alabama. Pflieger (1997) mapped five locations in Missouri, but none were more recent than 1965. Smith (1979) discussed records from a few locations in Illinois, but populations evidently no longer exist in those areas. Etnier and Starnes (1993) mapped four sites in Tennessee but noted that recent confirmed records are lacking. Ross (2001) mapped 14 sites in Mississippi, but only 3 were relatively recent. Gilbert (1992) mapped 10 locations in Florida, but the number of extant populations was not indicated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but presumably exceeds 10,000. This gar is uncommon to rare throughout most of the range, except locally in swamps and bayous of the south-central United States (Page and Burr 2011). However, Hoese and Moore (1998) stated that this gar is common in brackish water, frequently seen in the Gulf of Mexico, and common as a market fish in Louisiana. It is numerous enough to support a fishery in a reservoir in Tamaulipas, Mexico (Garcia de Leon et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Not much information is known about communication in alligator gars. Their lateral line system is used to detect motion in the water. They are also likely to use chemical cues and vision to some extent.

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Young alligator gars develop from eggs and then float to the water's surface, resembling sticks (Shultz, 2004). They have a disc on the bottom of their snouth that allows them to attach to rocks and other objects until their yolk is absorbed (Goddard, 2005). Shortly afterwards, the young begin searching for food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Females generally live longer than males and are larger, they may live from 26 to 50 years in the wild (Etnier and Starnes, 1993).

Typical lifespan

Status: wild:
50 (high) years.

Average lifespan

Status: wild:
26 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning occurs April to June in Louisiana (Suttkus 1963), possibly January to September in Oklahoma-Texas (Echelle and Riggs 1972). Seasonal variation in ovarian weight indicated peak spawning in July-August in northeastern Mexico (Garcia de Leon et al. 2001). In Alabama, females mature at age 11 and live to age 50; males mature at age 6 and live to age 26 (Irwin, cited by Boschung and Mayden 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating behaviors in this species are not known.

Female alligator gars lay eggs that are dark green or red and stick to rocks and vegetation. The eggs are poisonous if eaten. Alligator gar may take many years to reach sexual maturity, although little is known about reproduction in this species.

Breeding interval: Alligator gar probably breed once yearly.

Breeding season: Breeding occurs from May to July.

Range number of offspring: 138,000 (high) .

Average number of offspring: 77,000.

Range time to hatching: 6 to 8 days.

Average age at sexual or reproductive maturity (female): 11 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Alligator gars are oviparous. Once the eggs are laid, the young are left to survive on their own (Shultz, 2004).

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Atractosteus spatula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACTCGTTGATTCTTCTCCACTAATCACAAAGATATCGGCACCCTTTATATAGTATTTGGTGCCTGAGCCGGAATAGTCGGAACCGCCCTAAGCCTCTTAATTCGAGCAGAACTAAGTCAGCCTGGAACCCTCCTTGGAGATGACCAAATTTATAACGTCATCGTTACAGCGCACGCTTTCGTCATAATTTTCTTTATAGTAATGCCAGTTATAATTGGCGGGTTCGGGAACTGACTTGTCCCTTTAATAATTGGCGCCCCCGACATAGCCTTTCCCCGGATAAACAACATAAGCTTCTGACTTCTTCCACCCTCCTTCCTACTCCTCCTGGCCTCATCAGGAATTGAAGCCGGGGCCGGAACCGGATGAACGGTCTACCCACCCTTAGCCAGCAATCTCGCACACGCAGGAGCATCTGTTGATTTAACCATTTTTTCCCTTCACTTAGCCGGTATTTCATCAATCCTAGGCGCCATCAATTTTATCACGACCATTCTAAACATAAAACCACCCGCAGCTTCCCAGTACCAAACACCCCTATTTGTCTGGTCCGTCTTAATTACGGCAGTTCTATTATTACTCTCCCTGCCAGTTTTAGCAGCAGGAATTACAATACTATTAACGGACCGCAATCTCAATACTACCTTCTTTGACCCTGCAGGAGGAGGAGACCCGATCCTTTATCAACACCTATTCTGATTCTTCGGGCACCCTGAAGTATATATTCTTATCCTCCCCGGATTTGGAATGATCTCTCACATTGTAGCATACTATGCAGGTAAAAAAGAGCCATTTGGATATATAGGCATGGTCTGAGCTATAATGGCCATCGGGCTATTAGGATTTATCGTCTGAGCCCACCATATGTTTACAGTTGGCATAGACGTAGACACTCGAGCCTATTTCACCTCCGCTACAATAATTATTGCTATTCCAACAGGGGTAAAAGTATTTAGCTGATTAGCCACCCTTCACGGAGGCTCAATTAAATGAGACACCCCCCTCCTATGAGCCTTAGGCTTTATCTTCCTTTTTACAGTAGGAGGCCTAACAGGGATTGTCCTTGCCAACTCGTCCTTAGATATTATGTTACATGACACCTACTACGTTGTAGCCCACTTCCACTATGTCCTATCCATGGGGGCTGTATTCGCAATTATGGGAGCCTTCGTGCACTGATTCCCCCTATTCACAGGGTACACACTGCACAACACATGATCCAAAATCCATTTTGGGGTGATATTTGCAGGAGTAAATTTAACATTCTTCCCCCAACATTTTTTAGGACTTGCAGGAATACCACGACGATATTCTGACTACCCAGACGCCTATGCCCTCTGAAATACTATTTCCTCAATCGGATCCCTAGTCTCCCTCGTAGCCGGTATTATATTCCTTTTTATTGTTTGAGAAGCATTTTCAGCCAAACGAGAAGTCCTGTCAGTAGAATTAACCTCAACCAACGTGGAATGACTCCACGAATGCCCTCCCCCCTATCACACATATGAGGAACCTGCCTTTGTTCAAGTGCAAGCTCAACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Atractosteus spatula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Large range mainly in rivers and river-mouth estuaries in the central and southeastern United States and eastern Mexico; uncommon to rare in most of range, abundant enough to support fisheries in some areas; extirpated or disappearing in northern part of range, declining in the south; decline may be related to channelization, impoundments, frequent barge traffic, and commercial fishing.

Other Considerations: Of the 13 states in the U.S. range, ranked SX or SH in three, S1 or S2 in six, S3 in three, and S4 in one (Texas). The S4 rank in Texas may not reflect a recent evaluation of status. Two states with ranks of S3 (Tennessee and Florida) actually have very few recent occurrence records. Scarcity of this species in museum collections is in part related to the large size of most specimens that are captured (Gilbert 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alligator gar are not currently listed as endangered, threatened, or of special concern. There are some concerns about overfishing and indications that populations have declined in areas where their preferred habitat, bottomland swamps, has been destroyed through channelization and and the building of levees.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-50%

Comments: Trend over the past three generations is unknown but likely exceeds 10 percent and may exceed 30 percent. One generation is here estimated at 20 years.

Global Long Term Trend: Decline of 30-70%

Comments: Area of occupancy and abundance have declined over the long term, particularly in the northern part of the range. The degree of decline is uncertain but likely exceeds 30 percent. This gar was historically rare in Illinois (Smith 1979), with no confirmed recent records. It was known historically from the Ohio River in Ohio (Trautman 1981), with no confirmed recent records. In Missouri, Pflieger (1997) described evidence that numerous specimens had been collected in the Missouri section of the Mississippi River, but he knew of no records of this species in Missouri more recent than 1965. A drastic decline evidently has occurred in Tennessee, where the species may be extirpated (Etnier and Starnes 1993). Commercial fishermen report occasional captures, but the identity of these fishes is questionable (Etnier and Starnes 1993). In Oklahoma, "generally there has been a consistent decline in numbers" (Miller and Robison 2004). Robison and Buchanan (1988) reported that the population in Arkansas has declined drastically during the last 40 years and that recent confirmed records are few (typically large ones, perhaps indicating a decline in reproduction or recruitment). Formerly there was a significant commercial and sport fishery, but now the species is rarely captured. Historically of statewide distribution in Louisiana (Douglas 1974) but now declining in abundance (Bobby Reed, pers. comm., 1999). Long-term trend in Mississippi is unknown (Ross 2001); all but 3 of the 14 locations mapped in Mississippi by Ross were pre-1983. In Alabama, the species has declined in abundance (Boschung and Mayden 2004); and Mettee et al. (1996) noted that the species has become rare in inland sites in recent years. Small individuals (18-30 inches TL) were found (date not specified, but presumably recently) in brackish water in the Mobile Delta, indicating the occurrence of at least some recruitment. In Florida, the species is widely distributed in the panhandle, but the trend is unknown (Gilbert 1992). Populations may be declining in some Gulf Coastal areas where this gar remained common until recent years (Etnier and Starnes 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Local declines have been attributed to overfishing, habitat degradation from river channelization and impoundments, loss of spawning habitat and loss of passages between main river channels and floodplains, and frequent barge traffic (Gilbert 1992, Herkert 1992, Etnier and Starnes 1993, Pflieger 1997, Irwin et al. 2001, Boschung and Mayden 2004, Miller and Robison 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: None. No occurrences appropriately protected and managed

Comments: Given the typical habitat of this fish, it is doubtful whether any occurrences are effectively protected.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Supports a gillnet fishery in a reservoir in Tamualipas, Mexico (Garcia de Leon et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Because these fish are predators, they consume gamefish, (Shultz, 2004). In turn, they cause a problem for humans in terms of sport fishing and consumption. There are several undocumented reports of injuries to humans. Their eggs are poinsonous if consumed (Goddard, 2005).

Negative Impacts: injures humans (bites or stings, poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Alligator gars have been fished commercially (Knopf, 2002). In Lousiana, they are fished for food, acting as a substitute for lobster (Etnier and Starnes, 1993). Like many other fish, they are also collected for aquaria.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alligator gar

Preserved display of an alligator gar head

Alligator gars, Atractosteus spatula, are ray-finned euryhaline fishes related to bowfin in the superorder Holostei (ho'-las-te-i). The fossil record traces the existence of alligator gars back to the Early Cretaceous over a hundred million years ago. They are the largest in the gar family, and among the largest freshwater fishes in North America. Gars are often referred to as "primitive fishes", or "living fossils" because they have retained some morphological characters of their earliest ancestors, such as a spiral valve intestine which is also common to the digestive system of sharks, and they can breathe both air and water. Their common name was derived from their resemblance to American alligators, particularly their broad snout and long sharp teeth. They can grow to 10 ft (3.0 m) and weigh 300 lb (140 kg). Their body is torpedo shaped, usually brown or olive in color fading to a lighter whitish gray or yellowish ventral surface. They do not have scales like other fishes, rather they are armored with hard, enamal-like, diamond shaped ganoid scales that are jagged around the edges, and nearly impenetrable for protection against predation. Unlike other gar species, mature alligator gars have a dual row of large sharp teeth in the upper jaw which they use for impaling and holding prey. They are stalking, ambush predators, primarily piscivores, but will also ambush and eat water fowl and small mammals that may be floating on the water's surface oblivious to the stalking looming presence below them.

Alligator gars have been extirpated from much of their historic range due to habitat destruction, indiscriminate culling, and unrestricted harvests. Populations are now located primarily in the southern portions of the United States extending into Mexico. They are considered euryhaline because they can adapt to varying salinities ranging from freshwater lakes and swamps to brackish marshes, estuaries, and bays along the Gulf of Mexico.

For the past half century, alligator gars were perceived as a "trash fish", or "nuisance species" that were detrimental to sport fisheries, therefore targeted for elimination by state and federal authorities in the United States. Over the past decade, greater emphasis has been placed on the importance of alligator gars to the ecosystems they inhabit. As a result, they were afforded protection by restricted licensing. They are also protected under the Lacey Act which makes it illegal to transport fish in interstate commerce when in violation of state law or regulation. Several state and federal resource agencies are monitoring populations in the wild, and have initiated outreach programs to educate the public. Alligator gars are being cultured in ponds, pools, raceways and tanks by federal hatcheries for mitigation stocking, by universities for research purposes, and in Mexico for consumption.[1]

Anatomy and physiology[edit]

Gill of a juvenile gar

Alligator gars are the largest species of gar, and among the largest freshwater fishes found in North America. They can grow 8 to 10 ft (2.4 to 3.0 m) in length, and weigh over 300 lb (140 kg) at maturity. The largest alligator gar on record was inadvertently caught in the net of fisherman, Kenny Williams of Vicksburg, Mississippi while he was fishing the oxbow lakes of the Mississippi River on Valentine's Day, February 14, 2011. According to news reports, Williams was pulling up his net on Lake Chotard expecting to find his quota of buffalo fish. Instead, he discovered a large alligator gar tangled in his net. The gar was 8 ft 5 18 in (2.569 m) long, weighed 327 lb (148 kg), and its girth was 47 in (120 cm). According to wildlife officials, the age of the fish was estimated to be somewhere between 50 and 70 years old. Williams donated the fish to the Mississippi Museum of Natural Science in Jackson where it will remain on display.[2][3]

All gars have torpedo shaped bodies, but some distinguishing characteristics of adult alligator gars include their large size, heavy bodies, broad heads, short broad snouts, and large sharp teeth with double rows of teeth on their upper jaw. They are usually brown or olive in color fading to a lighter whitish gray or yellowish ventral surface. The dorsal and anal fins are positioned more toward the back of their bodies, and their caudal fin is abbreviate-heterocercal, or non-symmetrical.[4]

Alligator gars have gills, but unlike other fishes they also have a highly vascularized swim bladder lung that supplements gill respiration. The bladder not only provides buoyancy, it enables them to breathe air which is why they are able to inhabit bodies of water where most other fishes would die of suffocation. The bladder is connected to their mouth through a small pneumatic duct that allows them to breathe or gulp air when they break the surface, an action that is seen quite frequently on lakes in the southern United States during the hot summer months. The scales of alligator gars are not like the scales of other fishes. Their bodies are protected by overlapping, enamel-like ganoid scales that are diamond-shaped with jagged edges, and composed of a hard inner layer of bone and an outer layer of ganoin that is nearly impenetrable.[5]

Taxonomy and evolution[edit]

Lacépède first described the alligator gar in 1803. The original name was Lepisosteus spatula, but was later changed by E.O. Wiley in 1976 to Atractosteus spatula in order to recognize two distinct extant taxon of gars. Synonyms of Atractosteus spatula include Lesisosteus [sic] ferox (Rafinesque 1820), and Lepisosteus spatula (Lacepede 1803). Fossils from the order Lepisosteiformes have been collected in Europe from the Cretaceous to Oligocene periods, in Africa and India from the Cretaceous, and in North America from the Cretaceous to recent. Lepisosteidae is the only extant family of gar which has seven species all located in North and Central America.[4] The fossil record traces the existence of alligator gars back to the Early Cretaceous over a hundred million years ago.[6][7] Despite being a highly evolved species, alligator gars are often referred to as "primitive fishes", or "living fossils"[8] because they have retained a few morphological characters of their earliest ancestors with seemingly little to no apparent changes, such as a spiral valve intestine which is also common to the digestive system of sharks, an abbreviate-heterocercal tail, and a swim bladder lung for breathing both air and water.[4][5][9]

Feeding behavior[edit]

Alligator gars are stalking, ambush predators

Alligator gars are relatively passive, seemingly sluggish solitary fishes, but voracious ambush predators. They are opportunistic night predators, primarily piscivores, but they will also ambush and eat water fowl and small mammals that may be floating on the water's surface. Their method of ambush is to loom a few feet below the water's surface, and wait for unsuspecting prey to swim within reach. They lunge forward, and with a sweeping motion grab their prey, impaling it onto their double rows of sharp teeth.[5]

Diet studies have shown alligator gars to be opportunistic piscivores, and even scavengers depending on availability of their preferred food source. They occasionally ingest sport fishes, but the majority of stomach content studies suggest they feed predominately on forage fishes such as gizzard shad as well as invertebrates, and water fowl. Diet studies have also revealed fishing tackle and boat engine parts in the stomach contents.[10][11]

Spawning[edit]

As with most ancestral species, alligator gars are long lived, and sexually late maturing. Most females do not reach sexual maturity until after their first decade of life while males reach sexual maturity in half that time. The conditions for spawning must be precise for a successful spawn to occur. Preparation for spawning begins in the spring with the extended photo period and rising water temperatures, but flooding is also necessary to trigger the event. When rivers rise and spread over the floodplain, they create oxbows and sloughs, and inundate terrestrial vegetation which in turn provides protection and nutrient rich habitat for larval fishes, and fry. Once the water temperature has reached 68 to 82 °F (20 to 28 °C), and all the other criteria are met, gars will move into the grassy, weed laden shallows to spawn.[12][13]

Actual spawning occurs when a collection of males gather around gravid females, and begin writhing, twisting, bumping into and slithering over the tops of females, an activity which triggers the release of eggs. At the same time, males release clouds of milt to fertilize the eggs as they are released into the water column.[12] The sticky eggs then attach to submerged vegetation, and development begins. It takes only a few days for the eggs to hatch into larval fish, and another ten days or so for the larval fish to detach from the vegetation and start making their way as young fry.[13] Egg production is variable, and believed to be dependent on the size of the female. A common formula used for predicting the volume of eggs a female can produce is 4.1 eggs/gram of body weight which averages around 150,000 eggs per spawn. The eggs of alligator gars are bright red in color, and poisonous to humans if ingested.[5]

Distribution[edit]

Alligator gar caught in Moon Lake by Bill Valverde, 01/01/1951, Rio Grande, Texas

Natural range[edit]

Alligator gars use a wide variety of aquatic habitats, but most are found in the Southern United States in reservoirs and lakes, in the backwaters of lowland rivers, and in the brackish waters of estuaries, bayous and bays. They have occasionally been seen in the Gulf of Mexico.[5] In Texas and Louisiana it is common to see large gars breaking the surface in reservoirs, bayous, and brackish marshes. They are found throughout the lower Mississippi River Valley and Gulf Coast states of the Southern United States and Mexico as far south as Veracruz, encompassing the following states in the United States: Texas, Oklahoma, South Carolina, North Carolina, Virginia, Louisiana, Kentucky, Mississippi, Alabama, Tennessee, Arkansas, Missouri, Florida, and Georgia.[14] Reports suggest alligator gars were numerous throughout much of their northern range, however valid sightings today are rare, and may occur once every few years.[4] Records of historical distribution indicate alligator gars once inhabited regions as far north as central Kansas, Nebraska, Ohio, Iowa, and west-central Illinois where they are now listed as extirpated. The most northerly verified catch was in Meredosia, Illinois in 1922.[15]

Outside natural range[edit]

A few notable sightings of alligator gars have been reported outside North America. In November 2008, an alligator gar measuring 5.2 to 6.4 ft (1.6 to 2.0 m) in length was caught in the north of Esenguly, Turkmenistan by two officials of Turkmenistan Fishery Protection. Dr. R. Mayden, Saint Louis University and Dr. Eric Hilton, Virginia Institute of Marine Science confirmed it was Atractosteus spatula.[16]

On September 4, 2009 a 3 ft 3.37 in (1.0000 m) long alligator gar was found in Tak Wah Park in Tsuen Wan, Hong Kong. In the next two days, at least 16 other alligator gars, with the largest one measuring 4.9 ft (1.5 m) in length, were found in ponds in public parks in Hong Kong.[17] Nearby residents reported the alligator gars were released into the ponds by aquarium hobbyists, and had lived there for several years. However, after a complaint made by a citizen who falsely identified the fish as crocodiles, the use of terms like "horrible man-eating fish" were appearing in the headlines of some major local newspapers. Government officials removed all the alligator gars from the ponds claiming the species had no conservation value, and would negatively affect the local ecology if left in the ponds.[18]

On January 21, 2011, an alligator gar measuring 4 feet 11 inches (1.50 m) was caught in a canal in Pasir Ris, Singapore by two recreational fishermen. The fish was taken to a nearby pond where the pond owner confirmed it was an alligator gar, not an arapaima as the men initially thought.[19]

Human utilization[edit]

Early history[edit]

Native Americans in the south, and Caribbean peoples used the alligator gar's ganoid scales for arrow heads, breastplates, and as a shield to cover plows. Early Americans tanned the skins to make a strong, durable leather to cover their wooden plows, make purses, and various other items. Gar oil was also used by the people of Arkansas as a repellant against buffalo-gnats.[10]

For decades, alligator gars were perceived as a "nuisance fish" by state and federal authorities who targeted them for elimination to protect game fish populations,[20] and to prevent alleged attacks on humans, a claim that remains unsubstantiated with the exception of occasional injuries sustained from captured alligator gars thrashing around on the decks of boats.[5] Fishermen also participated in the slaughter of thousands of alligator gars all the while believing they were providing a great service. In 1995, KUHT channel 8, a member PBS television station located on the campus of the University of Houston in Houston, Texas, distributed and broadcast the first video documentary ever produced on alligator gar. The documentary, "Alligator Gar:Predator or Prey?", debuted nationally in prime time during the July Sweeps, and according to the Nielsen rating report provided to KUHT, was the number one rated program of the evening.[5] The documentary focused on the physiology and life history cycle of alligator gar, addressed the destruction of habitat, the unregulated culling and over harvesting of alligator gar from various lakes in Texas and Louisiana, and expressed concern for the future of the species at a time when it was still considered a "trash fish".[5] A decade passed before any significant action was taken to protect and preserve the remaining populations of alligator gar in the United States. The Missouri Department of Conservation has since partnered with Tennessee, Arkansas, Kentucky, Illinois, Alabama, Mississippi, Texas, Oklahoma, and Louisiana in restoration and management activities.[10]

Sport fish[edit]

6 ft (1.8 m) 129 lb (59 kg) alligator gar caught by K. Kirkland, Brazos River, Tx., 1991

The long time public perception of alligator gars as "trash fish", or "nuisance species" has changed with increasing national and international attention as a sport fish which some have attributed to features on popular television shows. Oklahoma, Texas, Arkansas, Mississippi, and Louisiana allow regulated sport fishing of alligator gars. Texas has one of the best remaining fisheries for alligator gars, and in concert with its conservation efforts to maintain a viable fishery, imposed a one-per-day bag limit on them in 2009.[21] The world record for the largest alligator gar caught on rod and reel is 279 lb (127 kg), caught by Bill Valverde, January 1, 1951, Rio Grande, Texas.[22] Alligator gars are also quite popular among bowfishers because of their large size, trophy potential, and fighting ability. The largest alligator gar taken by bowfishing is 365 lb (166 kg). It was caught in 1991 by Kirk Kirkland on the Brazos River in Texas.[23]

Commercialization and Aquaculture[edit]

Declining populations of alligator gars throughout their historic range have resulted in the need to monitor wild populations, and regulate commercial harvests. Alligator gars have a high yield of white meat filets and a small percentage of waste relative to body weight. The meat is sold to wholesale distributers, and also sold retail by a select few supermarkets where prices start at around $3.00/lb. Fried gar balls, grilled fillets, and fillets boiled in water with crab boil seasoning are popular dishes in the south. There is also a small cottage industry that makes jewelry out of ganoid scales, and also tans gar hides to produce leather for making lamp shades, purses, and a host of novelty items.[5][10]

Atractosteus gars, including alligator gars, tropical gars, and Cuban gars are considered good candidates for aquaculture particularly in developing regions where their rapid growth, disease resistance, easy adaptation to artificial feeds as juveniles, and ability to tolerate low water quality are essential. Their ability to breathe both air and water eliminates the need for costly aeration systems and other technology commonly used in aquaculture. In the Southern United States, as well as in parts of Mexico and Cuba, broodstocks have already been established, and are being maintained in their respective regions where they already are a popular food fish.[24]

Aquaria[edit]

Alligator gar maneuvering with pectoral fins in large zoo aquarium

Despite the large size alligator gars can attain, they are kept as aquarium fish. However, many fish labelled as "alligator gar" in the aquarium trade are actually smaller species. Alligator gars require a very large aquarium or pond, and ample resources in order for them to thrive in captivity. They are also a popular fish for public aquariums, and zoos. True alligator gars are illegal as pets in multiple areas but will occasionally show up in fish stores. Alligator gars are highly prized and sought after for private aquariums, particularly in Japan. According to some reports, large alligator gars could fetch as much as $40,000 in what some consider the "Japanese black market".[25] In June 2011, three men from Florida and Louisiana were indicted on charges of illegally removing wild alligator gars from the Trinity River in Texas, and attempting to ship them to Japan for private collectors. The indictments resulted from an undercover sting operation by special agents with the U.S. Fish & Wildlife Service, the Texas Parks and Wildlife Department, and the Florida Fish and Wildlife Conservation Commission.[26] The charges included violations of three separate provisions of the Lacey Act, specifically conspiracy to submit a false label for fish transported in interstate commerce, conspiracy to transport fish in interstate commerce in violation of state law or regulation; and conspiracy to transport and sell fish in interstate commerce in violation of state law or regulation.[27] Two of the conspirators pled guilty to one count, and the government dropped the other two charges against them. A third conspirator went to trial on all three counts, was acquitted on one count, and found guilty on two. The district court sentenced him to serve nine months in prison followed by one year of supervised release.[28] The case was appealed, and on April 15, 2014, the appellate court affirmed the judgment of the district court.[29]

References[edit]

  1. ^ S.E. Lochmann, Brandon W. Baker, Kyle T. Rachels, and Brett A. Timmons. "New Research". Aquaculture and Fisheries Center. University of Arkansas at Pine Bluff. Retrieved June 18, 2014. 
  2. ^ "Vicksburg Man Catches 327 Lb. Alligator Gar". WAPT News. February 18, 2011. 
  3. ^ Chad Love (February 23, 2011). "World Record Alligator Gar Pulled From Mississippi Lake Tangled in Fisherman's Net". Field & Stream. Retrieved April 19, 2014. 
  4. ^ a b c d Nathaniel Goddard. "Alligator Gar". FLMNH Ichthyology Department. Retrieved April 19, 2014. 
  5. ^ a b c d e f g h i B. Wills. "Alligator Gar". Earthwave Society. Retrieved April 14, 2014. 
  6. ^ Daniel E. Schwartz, Peter J. Allen (December 2013). "Comparative biochemistry and physiology. Part A, Molecular and integrative physiology". Mississippi State University Dept. of Wildlife, Fisheries and Aquaculture. 
  7. ^ American Society of Naturalists. The American Naturalist 35. University of Chicago Press. Retrieved May 30, 2014. 
  8. ^ Mayor, Adrienne (2005). Fossil Legends of the First Americans. Princeton University Press. p. 38. ISBN 9781400849314. 
  9. ^ Graham, Jeffrey B. (1997). Air-Breathing Fishes: Evolution, Diversity, and Adaptation. Academic Press. pp. 1–10. ISBN 0-12-294860-2. 
  10. ^ a b c d "Missouri Alligator Gar Management and Restoration Plan". Missouri Department of Conservation Fisheries Division. January 22, 2013. Retrieved July 2014. 
  11. ^ David L. Buckmeier (July 31, 2008). "Life History and Status of Alligator Gar (Atractosteus spatula), with Recommendations for Management". Heart of Hills Fisheries Science Center. Texas Parks and Wildlife Department. p. 5. Retrieved July 7, 2014. 
  12. ^ a b BBest Biological Subcommittee (November 2, 2009). "BBest Recommendations Report". Sabine/Neches BBest Biological Overlay Approach. Texas Commission on Environmental Quality. p. 8. Retrieved July 7, 2014. 
  13. ^ a b Shannon Thompkins (April 19, 2014). "Once a nuisance, alligator gar increasingly protected". Houston Chronicle. 
  14. ^ "Alligator Gar Technical Committee". Southern Division of the American Fisheries Society. Retrieved May 17, 2013. 
  15. ^ Poly, William J. (2001). "Distribution of the Alligator Gar, Atractosteus spatula (Lacépède, 1803), in Illinois". Transactions of the Illinois State Academy of Science 94 (3): 185–190. 
  16. ^ "Hazar Deňziniň Türkmen Kenarynda Amerikan Sowutly Çortanyň Tutulmagynyň Ilkinji Wakasy" (in Turkish). Türkmenistanyò Tebigaty goramak ministrligi. Retrieved May 17, 2013. 
  17. ^ "Monster exotic fish found in Hong Kong ponds". AFP. September 5, 2009.
  18. ^ Nip, Amy (September 6, 2009). "Dumped fish prove to be slippery customers during pond clearance". South China Morning Post.
  19. ^ "Friends catch 1.5m 'monster' fish from Pasir Ris canal after long struggle". The Straits Times. January 21, 2011. 
  20. ^ Echevarria, Carlos (February 5, 2013). "Alligator Gar, Atractosteus spatula". Warm Springs National Fish Hatchery. US Fish & Wildlife Service. Retrieved July 7, 2014. 
  21. ^ "Alligator Gar". Texas Parks and Wildlife Department. Retrieved April 21, 2014. 
  22. ^ "State Freshwater Records: Rod and Reel". Texas Parks & Wildlife. Retrieved May 17, 2013. 
  23. ^ "Alligator Gar". Texas Fishing Guides. Retrieved May 17, 2013. 
  24. ^ Alfaro, Roberto M., Gonzales, Carlos A., Ferrara, Allyse (2008). "Gar biology and culture: status and prospects". Chapter 39. Aquaculture Research. pp. 748–763. Retrieved July 7, 2014. 
  25. ^ Horswell, Cindy (June 17, 2011). "Indictments accuse 3 of taking alligator gar fish out of Trinity". Houston Chronicle. 
  26. ^ Jon Berstein (October 15, 2011). "Monster fish tale: Alligator gar sting ends in conviction". SunSentinel. 
  27. ^ "Accused alligator gar smugglers busted in trinity river operation". ABC 9 KTRE. 2011. 
  28. ^ "Monthly Bulletin". Regional EnvironmentalEnforcement Association. October 2012. Retrieved April 2014. 
  29. ^ "Opinions". U.S. Court of Appeals. April 15, 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the genus Lepisosteus. Placed by Wiley (1976) in genus Atractosteus, along with L. tristoechus, L. tropicus, and a number of fossil species. Nelson (1984) regarded Atractosteus as a subgenus of Lepisosteus. The 1991 AFS checklist (Robins et al. 1991) also included this species in the genus Lepisosteus. Page and Burr (1991), Etnier and Starnes (1993), and Nelson (1994) followed Wiley's use of the generic name Atractosteus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!