Overview

Comprehensive Description

Biology

Found in coastal and oceanic waters (Ref. 5578). Feeds on plankton (Ref. 30573). Ovoviviparous (Ref. 50449). Generally found in schools, leaping out of the water (Ref. 11228). Caught rarely in the tuna gillnet fisheries. Utilized for its gill filter plates (high value), meat, cartilage and skin (Ref.58048).
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Indian Ocean and Western Central Pacific: the range of this species is not well documented (White et al. 2006b), but it is reported from South Africa (edge of range), Tanzania (Zanzibar), India, Sri Lanka, Indonesia, Seychelles (Compagno and Last 1997), Malaysia (Ahmed et al. 2004), Oman (Randall 1995), Somalia (Sommer et al. 1996) and Philippines (Compagno et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: eastern coast of Africa to Indonesia.
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

120 cm WD (female); max. published weight: 30.0 kg (Ref. 11228)
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
  • Heemstra, P.C. 1995 Additions and corrections for the 1995 impression. p. v-xv. In M.M. Smith and P.C. Heemstra (eds.) Revised Edition of Smiths' Sea Fishes. Springer-Verlag, Berlin. (Ref. 11228)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A small devilray with a short head bearing short head fins; dorsal fin white-tipped, and pectoral fins with slightly curved tips; upper surface with no denticles and tail shorter than disc, with no spine (Ref. 5578). Dark brown above, white below (Ref. 5578).
  • Compagno, L.J.V., D.A. Ebert and M.J. Smale 1989 Guide to the sharks and rays of southern Africa. New Holland (Publ.) Ltd., London. 158 p. (Ref. 5578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An uncommon inshore, primarily shelf pelagic species found in continental coastal areas but not extending into the epipelagic zone (Compagno and Last 1999).

As with all Myliobatiformes, the reproductive mode of M. kuhlii is livebearing and histotrophic, with embryonic nutrition supplied from a protein- and lipid-rich histotroph from highly developed trophonemata. A single, relatively large pup is produced per litter (Compagno and Last 1999, White et al. 2006b). Long resting periods may account for extended reproductive cycles in mobulid species. This species feeds on planktonic crustaceans and possibly small fishes and cephalopods (Sommer et al. 1996, White et al. 2006b) and reaches a maximum size of about 119 cm disc width (DW) (White et al. 2006b). Size at birth is around 31 cm DW (Compagno and Last 1999). Males mature at 115–119 cm (DW) (White et al. 2006b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in coastal and oceanic waters. Feeds on plankton.
  • Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Probably giving birth to only one pup; born at ~31 cm WD (Ref.58048).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mobula kuhlii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACTTAATCTTTGGTGCATGAGCAGGGATAGTGGGCACTGGTCTTAGCCTACTAATTCGAACGGAATTAAGCCAACCAGGGGCCTTACTAGGTGACGACCAAATTTACAATGTGGTAGTTACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGACTAGTTCCTTTAATAATTGGTGCTCCAGACATGGCCTTCCCTCGAATAAATAACATAAGTTTTTGACTCCTTCCTCCATCCTTCCTCTTACTACTAGCTTCAGCAGGAGTAGAAGCTGGGGCCGGGACTGGGTGAACTGTCTATCCTCCTCTGGCCGGTAATCTAGCACATGCTGGAGCCTCTGTAGATCTTACTATCTTTTCCCTGCACTTAGCCGGGGTCTCCTCCATTTTAGCATCAATCAATTTTATTACTACAATTATCAACATGAAACCACCTGCAATTTCTCAGTATCAAACACCCTTGTTTGTCTGATCTATTCTAATTACAACTGTTCTCCTCTTATTATCCCTTCCCGTCCTAGCAGCAGGCATTACTATGCTTCTCACAGATCGTAATCTTAATACAACCTTCTTTGATCCGGCAGGGGGTGGAGATCCTATTCTCTACCAACATCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mobula kuhlii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Bizzarro, J., Smith, W., White, W.T. & Valenti, S.V.

Reviewer/s
Fowler, S.L. & IUCN SSG Pelagic Shark Red List Workshop participants (Shark Red List Authority)

Contributor/s

Justification
The Shortfin Devilray (Mobula kuhlii) is an uncommon, inshore devil ray with a patchy distribution in the Indian Ocean and western central Pacific, reaching 119 cm disc width. Mobulid rays are particularly vulnerable to overfishing as their fecundity is the lowest of all elasmobranchs (typically one pup per litter and a gestation period assumed to be 1–3 years). Mobulid rays, including Shortfin Devilray, are taken by surface gill net, longline, purse seine and directed harpoons. This species is taken in both target and bycatch fisheries. The Shortfin Devilray occurs primarily in coastal waters, placing it within the range of inshore fisheries that are intensive in many parts of its range. Directed mobulid fisheries have been reported in India, Sri Lanka, and Thailand, and the high value of gill rakers in some areas is driving a dramatic increase in the catch of mobulids in Indonesia. Data to determine population trends are unavailable because mobulid fisheries are generally poorly documented and specific catch data are rarely recorded. Because species-specific data required to assess population trends are unavailable this species is currently assessed as Data Deficient. However, given that this species is of low reproductive potential and is exploited in intensive target and bycatch fisheries in parts of its range, further information is urgently required. Obtaining such information to enable reassessment of the species should be a priority.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Uncommon (Compagno and Last 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Mobulid rays are taken by surface gill net, longline, purse seine and directed harpoons throughout much of their range, however detailed information on these fisheries is poorly documented (White et al. 2006a).

Mobula kuhlii is vulnerable to net gear, in particular gill nets, and is taken as a target or utilised bycatch in Indonesia and likely throughout much of its range. In Indonesia mobulid rays are landed as bycatch by artisanal gillnet fishers who target tuna. White et al. (2006a) conducted a study of the bycatch of mobulid rays in the drift gillnet fishery for skipjack tuna off Indonesia. Of 409 mobulid rays observed at four landing sites in eastern Indonesia from April 2001 to October 2005, M. kuhlii was the most rarely recorded and composed only 2% of the total rays, in this part of its range.

The high value of gill rakers in some areas is driving a dramatic increase in the catch of mobulids in Indonesia, where some fishers are now targeting devil rays, and their meat, cartilage and skin are also utilised (White et al. 2006). Although specific catch details are unavailable because of poor documentation in fisheries, mobulid rays appear to be particularly susceptible to overfishing as their fecundity is the lowest of all elasmobranchs (with litter sizes of typically only one pup and a gestation period assumed to be 1–3 years) (White et al. 2006a).

Directed mobulid fisheries have also been reported in other areas of this species’ range, including India, Sri Lanka and Thailand (Compagno and Last 1999, White et al. 2006a). Given the vulnerable life-history characteristics of this species, it is highly unlikely to be able to sustain continued directed fishing. Manta rays were targeted in the Philippines until protection was introduced for them in this area in 1988, as a result of international concern for the sustainability of such fisheries (see Conservation Measures below) (White et al. 2006a). Directed artisanal elasmobranch and ray fisheries using surface and bottom gillnet and line, also operate off Tanzania and a variety of artisanal multi-species artisanal net and line fisheries operate off South Africa (www.wiofish.org).Traditional fisheries for rays operate off Oman, using bottom lines and fixed gillnets. Rays are also often caught incidentally using beach seines off Oman (FAO 2008). Furthermore this species’ preference for coastal waters places it within the range of inshore fisheries, which are known to be intensive in many parts of its range, including India, Sri Lanka, Tanzania and Indonesia (Young et al. 2005, Flewwelling and Hosch 2006, Mngulwi 2006, Morgan 2006).

A recent review of the state of marine capture fisheries management in the Indian Ocean, noted that directed fisheries for sharks and rays exist in the Maldives, Kenya, Mauritius, Seychelles, South Africa and Tanzania and their status is considered probably fully to overexploited in the southwestern Indian Ocean (Young et al. 2006). The same review noted that ‘Rays, stingrays, mantas nei’ (a catch category that includes mobulid rays) are moderately to fully exploited in Indonesia, Thailand and Malaysia (Young et al. 2006). The life-history characteristics of this species, including very low fecundity, make it more vulnerable to exploitation relative to other more productive species of elasmobranchs included under these categories.

Mobulid rays are valuable for their branchial fiter plates, which are exported from Indonesia to Hong Kong, Taiwan and Singapore and ground down for use in traditional Chinese medicines (White et al. 2006a). The skins, cartilage and flesh are also utilised for human consumption and the cartilage also used as a ‘filler’ for low-grade shark fin soup (White et al. 2006a).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Additional research is needed to quantify the extent of target and non-target fisheries take for this species throughout its range. Further information on the species’ life history would also be beneficial for future assessments.

Elasmobranch fisheries are generally unmanaged throughout Southeast Asia and indeed elsewhere in the range of this species, and attempts to regulate fisheries in these regions would greatly improve conservation of M. kuhliii and other chondrichthyans. The capture of mobulid rays in the Philippines was banned with a Fisheries Administrative Order (FAO 193) (known as the “Whale shark and Manta Ray Ban”), issued in 1988.

The development and implementation of management plans (national and/or regional e.g. under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species across the regions where this ray occurs.

The vulnerability of mobulids and increasing catches requires urgent international conservation measures. These will need to focus on harvest and trade management.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Ahmad, A., A.A. Abdul Haris Hilmi, A.C. Gambang, S. Ahemad and A.R. Solahuddin (eds.) 2004 Elasmobranch resources, utilization, trade and management in Malaysia. Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Center. (Ref. 53392)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!