Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Aceraceae -- Maple family

    Ronald P. Overton

        Boxelder (Acer negundo) is one of the most  widespread and best known of the maples. Its other common names  include ashleaf maple, boxelder maple, Manitoba maple, California  boxelder, and western boxelder. Best development of the species  is in the bottom-land hardwood stands in the lower Ohio and  Mississippi River valleys, although it is of limited commercial  importance there. Its greatest value may be in shelterbelt and  street plantings in the Great Plains and the West, where it is  used because of its drought and cold tolerance.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Acer negundo (boxelder or ashleaf maple, with numerous other common names) is the most widely distributed North American maple species, ranging throughout the U.S. and Canada and south into Mexico and Guatemala. Leaves and form vary considerably across its geographical range; six subspecies are recognized. Boxelder is the only North American maple species with compound leaves.

The common name, “boxelder,” refers to the resemblance of its leaves to elder (Sambucus) and the use of the soft wood for box making. “Ashleaf maple,” refers to the resemblance to ash (Fraxinus).

Boxelder is a small, deciduous, fast-growing, short-lived tree growing to 20 m tall, with a broad rounded crown. It often branches low into multiple trunks, which may grow almost parallel to the ground, and can form dense thickets. The bark is light brown-gray with shallow fissures, becoming deeply furrowed. Twigs are slender, shiny green, usually glabrous (without hairs), and often have a whitish to pink or violet waxy coating (glaucous) when young. The leaves are opposite, pinnately compound with 3 to 9 leaflets, long-pointed, coarsely toothed and often shallowly lobed. The flowers are yellow-green, about 5 mm long; the species is generally dioecious (functional male and female flowers occur on separate trees; Wagner 1975; Fewless 2011). Fruits are long-stalked clusters of winged nutlets (samaras) in a pair, 2.5-4 cm long.

Boxelder is generally a tree of river bottoms and disturbed sites on heavy, wet or seasonally flooded soils, where it usually follows cottonwood and willow species in colonizing alluvial bottoms. Populations in native habitats have decreased because of clearing of bottomland forest for agriculture, but they have greatly increased in urban areas, where it readily colonizes disturbed sites due to its prolific seed production, wide dispersal, ease of germination, tolerance of cold, drought, and low-oxygen conditions, and fast growth on clay or heavy fill. It frequently grows along fencerows, railroad tracks, ditches, and abandoned lots (Michigan Flora Online 2011).

Boxelder was widely planted in the Great Plains as a shelterbelt tree—its shallow, fibrous root system helped reduce wind erosion and dust storms—but shelterbelts have largely been removed. It was also widely planted in the U.S. as a street tree, and ornamental cultivars have been developed (including forms with variegated leaves and without seeds).

It has been planted in Europe, Australia, and South America as a roadside, park, garden, and shelterbelt tree, and has naturalized widely in disturbed areas and along riverbanks. It is considered invasive in Poland, Germany, Austria, Russia, Latvia, and Lithuania (Mędrzycki 2011), as well as Australia, New Zealand, China, and Chile (USFS 2011).

Boxelder is sometimes confused with poison ivy (Toxicodendron radicans), because its compound leaves often have three leaflets. A key distinction is that boxelder leaves are opposite rather than alternate.

The boxelder bug (Boisea trivittata, family Rhopalidae) commonly associates with boxelder. The insects cause little damage to the trees, but are considered a pest species because they invade human habitation, often in large numbers, with the onset of cold weather (Hahn and Ascerno 2007).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Jacqueline Courteau, modified from USDA NRCS PLANTS Database.

Supplier: Jacqueline Courteau

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Comments

Box Elder is a very unusual Acer sp. (Maple) because of its compound leaves. However, it produces pairs of samaras (winged seeds) that closely resemble those of other trees in this genus. Another unusual characteristic is the olive green bark of the branches. This bark later becomes more rough and gray as it matures. Because of the similar appearance of their compound leaves, it is possible to confuse young shoots of Box Elder with Poison Ivy (Toxicodendron radicans). Unlike Box Elder, the leaves of Poison Ivy never have more than 3 leaflets, and the flowers and fruits of these two species are quite different.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This is a small tree up to 60' tall with a trunk up to 3' across. It branches abundantly and has a broad well-rounded crown. On old trees, the gray bark forms deep curving furrows, while the gray bark of young trees forms furrows that are shallow and more erratic. Young branches are olive green and smooth with scattered white lenticels; less often, they are purple. The leaves develop oppositely from each other on young shoots; they are odd-pinnate with 3-7 leaflets. The leaflets are 2-4' long and about half as much across; they are more or less ovate in shape, coarsely dentate, and often shallowly cleft. Sometimes the terminal leaflets are moderately cleft to form 3 distinct lobes. The upper leaf surfaces are yellowish green, light green, or medium green, while the lower leaf surfaces are pale green and either hairless or slightly pubescent. Each leaflet has a short slender petiole at its base. The rachis (central stalk) of each compound leaf is hairless and often reddish. Box Elder is dioecious with male and female flowers on separate trees. Initially, dense clusters of drooping male and female flowers develop at about the same time, or a little ahead, of the leaves during early to mid-spring. Later, the clusters of female flowers elongate into drooping racemes. The male flowers have pedicels that are long, slender, and hairy. Each male flower consists of 5 small green sepals, no petals, and about 5 exerted stamens. The large anthers of the stamens are dark red initially, although they later turn brown before withering away. Each female flower has 5 greenish red sepals, no petals, and a pistil with a long style that is deeply forked. The flowers are wind-pollinated. Each female flower is replaced by a pair of samaras (winged seeds). Each samara is 1–1½' long. The samaras are initially green, but they later turn brown and often persist on the tree through the winter. The root system is woody. Vegetative shoots from underground runners are not produced. Cultivation
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

General: Maple Family (Aceraceae): Boxelder is a native tree growing to 20 m tall, with broad rounded crown, usually developing a shallow, fibrous root system; bark light gray-brown with shallow fissures, becoming deeply furrowed; twigs slender, shiny green, usually glabrous but sometimes hairy. The leaves are opposite, 13-20 cm long, pinnately compound with 3(-5 or more) leaflets 5-10 cm long and 3-6 cm wide, long-pointed, coarsely toothed and often shallowly lobed. The flowers are yellow-green, about 5 mm long, the male (staminate) flowers fascicled, the female (pistillate) flowers in drooping racemes; most trees are either male or female (the species is essentially dioecious), but bisexual flowers occur on a few trees (technically polygamo-dioecious). Fruits are winged nutlets (samaras) in a pair, 2.5-4 cm long, clustered on long stalks. The common name refers to the resemblance of leaves to those of ash (Fraxinus). Boxelder, its other often used common name, refers to a resemblance to elder (Sambucus) and the use of the soft wood for box making.

Boxelder is unusual among American maples in having compound leaves. Apart from the opposite leaves, seedlings and young saplings of Boxelder bear a remarkable resemblance to poison ivy (Toxicodendron radicans) and are often mistaken for it by beginning naturalists.

Variation within the species:

Substantial variation occurs over the range of the species; numerous forms and varieties have been described, but only six varieties currently recognized (in some treatments, for example, see McGregor 1986). These are primarily distinguished by coloration of the branches, twig and fruit pubescence, and leaflet number.

Var. arizonicum Sarg. – Arizona and New Mexico

Var. californicum (Torr. & Gray) Sarg. – California

Var. interius (Britt.) Sarg. – midwest US into the western states

Var. negundo ­– the eastern half of the US, with naturalized western outlyers

Var. texanum Pax – south-central US

Var. violaceum (Kirchn.) Jaeger – north-central US and most of Canada

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 2 people

Average rating: 2.5 of 5

Distribution

Boxelder is widespread in riparian and palustrine communities throughout
most of the contiguous United States. Its range extends from New Jersey
and central New York west through extreme southern Ontario, central
Michigan, northern Minnesota, central Manitoba, central Saskatchewan,
southern Alberta and central Montana, eastern Wyoming, Utah, and
California; and south to southern Texas and central Florida. It is also
local in New Hampshire, Vermont, Massachusetts, Connecticut, Idaho, and
Nevada. Boxelder has been naturalized in Maine, southern Quebec, New
Brunswick, Nova Scotia, Prince Edward Island, and in southeastern
Washington and eastern Oregon. Varieties of boxelder occur in the
mountains of Mexico (Nuevo Leon, San Luis Potosi, and south to
Chihuahua) and in Guatemala [32].

General distribution by variety is as follows [25]:

var. negundo -- eastern United States and introduced to eastern
Washington and Oregon
var. interior -- Rocky Mountains to Arizona and Canada
var. violaceum -- northeastern United States and northern Great Plains
var. texanum -- western Missouri, eastern Kansas and throughout the
Southeast
var. californicum -- California
var. arizonicum -- Arizona and New Mexico
  • 32. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]
  • 25. Hitchcock, C. Leo; Cronquist, Arthur. 1961. Vascular plants of the Pacific Northwest. Part 3: Saxifragaceae to Ericaceae. Seattle, WA: University of Washington Press. 614 p. [1167]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Box Elder is common throughout Illinois; it can be found in all counties (see Distribution Map). Habitats include floodplain forests, open disturbed woodlands, woodland edges, thickets, river banks, fence rows, shallow ditches, roadsides, areas near bridges, and urban waste areas. Sometimes Box Elder colonizes upland habitats as well if they are not too shady. Generally, habitats with a history of some disturbance are preferred.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
3 Southern Pacific Border
6 Upper Basin and Range
8 Northern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AZ AR CA CO CT DE FL GA ID
IL IN IA KS KY LA ME MD MA MI
MN MS MO MT NE NV NH NJ NM NC
NY ND OH OR PA SC SD TN TX UT
VA WA WV WI WY AB MB NS ON PE
PQ SK MEXICO

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boxelder is the most widely distributed of all the North  American maples, ranging from coast to coast and from Canada to  Guatemala. In the United States, it is found from New York to  central Florida; west to southern Texas; and northwest through  the Plains region to eastern Alberta, central Saskatchewan and  Manitoba; and east in southern Ontario. Further west, it is found  along watercourses in the middle and southern Rocky Mountains and  the Colorado Plateau. In California, boxelder grows in the  Central Valley along the Sacramento and San Joaquin Rivers, in  the interior valleys of the Coast Range, and on the western  slopes of the San Bernardino Mountains. In Mexico and Guatemala,  a variety is found in the mountains. Boxelder has been  naturalized in New England, southern Quebec, New Brunswick, Nova  Scotia, and Prince Edward Island; and in the Pacific Northwest in  southeastern Washington and eastern Oregon.

   
  - Native range of boxelder

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adaptation

Boxelder is natively a tree of river bottoms and disturbed sites on heavy, wet soils, often seasonally flooded (up to 30 days). It is one of the most common bottomland trees throughout its range, usually following the pioneer species of cottonwood and willow in colonizing alluvial bottoms, then growing with silver and red maples, American elm, American sycamore, and sweetgum. Populations in native habitats have decreased because of clearing of bottomland forest for agriculture, but they have greatly increased in urban areas. Success of the species on disturbed urban sites owes to its prolific seed production and wide dispersal, ease of germination, tolerance of low oxygen conditions, and fast growth on clay or heavy fill. Boxelder also is found as a pioneer species on disturbed upland sites where a seed source is nearby.

Flowering: March-May (with or just before the leaves), fruiting: August-October. The flowers are wind pollinated but also visited by bees.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boxelder is the most widely distributed of all American maples – its native range extends from the east coast of the U.S. to California, and from Alberta to southern Mexico and Guatemala. The range is relatively continuous in the eastern U.S., but broken into small areas in the West and toward Central America. It has become naturalized in areas far outside of its native range, including Europe. It is not known from northern North America. For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Acer fauriei H. Lév. & Vaniot:
Japan (Asia)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 1.0 of 5

Localities documented in Tropicos sources

Acer negundo L.:
Argentina (South America)
Canada (North America)
United States (North America)
Bolivia (South America)
Mexico (Mesoamerica)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 1.0 of 5

Physical Description

Morphology

Description

Trees to 20 m tall, dioecious. Bark yellowish brown or gray-brown. Branchlets glabrous, those of present year green, older ones yellowish brown; winter buds small, scales 2(or 3) pairs. Leaves deciduous; leaf blade 10-25 cm, papery, pinnate; petiolules 5-7 cm, pubescent, glabrescent; leaflets 3-7(-9) per petiole; leaflet blades ovate or elliptic-lanceolate, 8-10 × 2-4 cm, base rounded or truncate, margin entire or with 3-5 teeth, apex acute. Pistillate inflorescence pendulous, racemose or compound racemose, axillary from leafless buds, 15-50-flowered. Staminate inflorescence usually a cluster of 4 flowers. Flowers 4-merous. Petals and disk absent. Stamens purplish, 4-6. Ovary glabrous. Samaras brownish yellow; nutlets convex, glabrous; wing including nutlet 3-3.5 cm × 8-10 mm, wings spreading acutely or nearly erectly. Fl. Apr, fr. Sep. 2n = 26.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

More info for the terms: dioecious, shrub, tree

Boxelder is a native deciduous small to large tree with an irregular
form. The trunk often divides near the ground into a few long,
spreading, rather crooked limbs, which branch irregularly to support a
broad, uneven crown. When growing among other trees, boxelder forms a
high, open crown, with the undivided portion of the trunk much longer
and usually straighter than that of an open-grown tree [27]. This
variable-sized tree may reach 70 feet (21 m) in height and 3 feet (0.92
m) in diameter but is more often medium sized, from 40 to 50 feet (12-15
m) high and from 1 to 2 feet (0.3-0.6 m) in diameter [27]. Boxelder may
also appear as a large shrub [50], and in upland soil on the Great
Plains this tree is usually only about 25 feet (8 m) high with low,
crooked branches [45].

Boxelder has a fast growth rate [33,41] and a short life span [46]; it
typically lives for 75 years, with 100 years maximum longevity [33].
Growth is rapid when young; long, smooth, green annual shoots extend 2
feet (0.6 m) or more in a year. At maturity growth slows and brittle
trunks and limbs shatter; old trunks frequently put out clusters of
sprouts and sometimes develop large burls [31].

A drought-tolerant tree once established, boxelder's roots are shallow
and spreading, except on deep soils [41,46]. The bark is light grey and
smooth but becomes furrowed into narrow, firm ridges and darkens with
age. Twigs are stout, light green to purplish or brownish with a
polished look or are often covered with a whitish bloom that is easily
rubbed off. The blunt buds are 0.125 to 0.25 inch (2-5 mm) long with
one or two pairs of scales and are coated with fine white hairs [27].

Boxelder is the only maple with divided leaves. The three to seven
leaflets are from 6 to 15 inches (15-38 cm) long, light green above and
greyish green below, usually without hairs. The leaflets are shallowly
lobed or coarsely toothed [27]. This completely dioecious tree has pale
green male and female flowers with a strongly pronounced reduction of
flower parts, and contains no rudimentary parts of the opposite sex.
Male flowers are on slender stalks in loose clusters, and female flowers
are arranged along a separate stem [27,54].

The fruit is composed of two fused, winged samaras which eventually
separate upon shedding. The angle separating the two wings is less than
60 degrees [27]. The samaras, about 1.5 inches (4 cm) long, hang in
long chains on slender stalks, mature in autumn, and remain on the tree
well into the winter [31]. Each contains a single seed without an
endosperm [39]. Seeds are 2 to 3 times as long as they are wide and are
markedly wrinkled.

Many ecotypes of this species occur. Varieties are distinguished by the
morphological characteristics of glaucousness, pubescence, or color of
the branches and/or samaras.
  • 27. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 31. Lanner, Ronald M. 1983. Trees of the Great Basin: A natural history. Reno, NV: University of Nevada Press. 215 p. [1401]
  • 33. Loehle, Craig. 1988. Tree life history strategies: the role of defenses. Canadian Journal of Forest Research. 18(2): 209-222. [4421]
  • 39. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 41. Preston, Richard J., Jr. 1948. North American trees. Ames, IA: The Iowa State College Press. 371 p. [1913]
  • 45. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]
  • 46. Sutton, Richard F.; Johnson, Craig W. 1974. Landscape plants from Utah's mountains. EC-368. Logan, UT: Utah State University, Cooperative Extension Service. 135 p. [49]
  • 50. Van Dersal, William R. 1938. Native woody plants of the United States, their erosion-control and wildlife values. Washington, DC: U.S. Department of Agriculture. 362 p. [4240]
  • 54. Wright, Jonathan W. 1953. Notes on flowering and fruiting of northeastern trees. Station Paper No. 60. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 38 p. [5009]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Deciduous tree. Leaves pinnately compound, usually trifoliolate. Flowers apetalous, 4-merous.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Synonym

Acer fauriei H. Léveillé & Vaniot.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Key Plant Community Associations

Boxelder is a component of various deciduous forest plant associations
in the Great Plains. It is associated with the following overstory
dominants: green ash (Fraxinus pennsylvanica), narrowleaf cottonwood
(Populus angustifolia), plains cottonwood (P. sargentii), aspen (P.
tremuloides), willow (Salix spp.), and bur oak (Quercus macrocarpa). In
Arizona and New Mexico, boxelder is the overstory dominant in several
high elevation riparian forests. In much of this species' range there
are no described plant communities.

Published classification schemes listing boxelder as a member of various
community types (cts), habitat types (hts), or dominance types (dts) are
presented below.

Location Classification Authority

AZ, NM riparian cts Szaro 1990
MT riparian dts Hansen & others 1988
MT, se ID riparian cts Padgett & others 1989
sw NM riparian hts Medina 1986
sc OK bottomland cts Petranka & Holland 1980
SD,ND: Custer NF general veg. hts Hansen & Hoffman 1988

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

K011 Western ponderosa forest
K016 Eastern ponderosa forest
K017 Black Hills pine forest
K018 Pine - Douglas-fir forest
K019 Arizona pine forest
K023 Juniper - pinyon woodland
K025 Alder - ash forest
K033 Chaparral
K037 Mountain-mahogany - oak scrub
K038 Great Basin sagebrush
K055 Sagebrush steppe
K056 Wheatgrass - needlegrass shrubsteppe
K063 Foothills prairie
K064 Grama - needlegrass - wheatgrass
K065 Grama - buffalograss
K066 Wheatgrass - needlegrass
K067 Wheatgrass - bluestem - needlegrass
K070 Sandsage - bluestem prairie
K074 Bluestem prairie
K081 Oak savanna
K098 Northern floodplain forest
K099 Maple - basswood forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

More info for the term: shrub

FRES15 Oak - hickory
FRES16 Oak - gum - cypress
FRES17 Elm - ash - cottonwood
FRES18 Maple - beech - birch
FRES19 Aspen - birch
FRES21 Ponderosa pine
FRES28 Western hardwoods
FRES29 Sagebrush
FRES34 Chaparral - mountain shrub
FRES35 Pinyon - juniper
FRES36 Mountain grasslands
FRES38 Plains grasslands
FRES39 Prairie

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat characteristics

Boxelder generally grows on moist sites along lakes and streams, on
floodplains, and in low-lying wet places where its shallow root system
can find abundant moisture [31]. Hardy to extremes of climate [41],
boxelder is drought tolerant once well established and can also
withstand short periods of flooding [46].

Soils: This species is able to tolerate a wide variety of soils but
shows a strong preference for well-drained soils [35]. Although
boxelder will grow on soils from gravel to clay, it grows best on deep,
sandy loam, loam, or clay loam soils with a medium to rocky texture and
a pH of 6.5 to 7.5 [9].

Associates: Throughout its range, boxelder is most often associated
with various species of cottonwood (Populus spp.) and willow (Salix
spp.). On the northern Great Plains, boxelder will generally outlive
cottonwood and willow to become an associate in American elm (Ulmus
americana), hackberry (Celtis occidentalis), mulberry (Morus spp.), and
green ash communities [2]. In the central Great Plains and in the
eastern United States, boxelder occurs with elms (Ulmus spp.), sugar
maple (Acer rubrum), basswood (Tilia spp.), and ashes (Fraxinus spp.),
which eventually replace boxelder in the overstory along with other more
durable and shade-tolerant species [31,51]. At higher elevations on the
Utah plateaus, boxelder occurs in the riparian zone with water birch
(Betula occidentalis), narrowleaf cottonwood (Populus angustifolia),
willows, and blue spruce (Picea pungens) [31]. In New Mexico and
Arizona, scattered along streambeds in riparian forests at higher
elevations, boxelder is a typical canopy dominant with Arizona alder
(Alnus oblongifolia) and coyote willow (Salix exigua) [35].

Elevation: The elevational ranges for boxelder in several states
are as follows [9,29,31,35,36,46]:

AZ from 4,450 to 8,000 feet (1,356-2,438 m)
CO 4,500 to 7,870 feet (1,372-2,400 m)
MT 2,240 to 4,500 feet (680-1,372 m)
NE 2,600 to 4,500 feet (792-1,372 m)
NM 6,350 to 6,775 feet (1,935-2,065 m)
ND 2,310 to 3,840 feet (704-1,170 m)
SD 3,000 to 3,500 feet (914-1,067 m)
UT 4,000 to 10,000 feet (1,219-3,048 m)
WY 3,500 to 7,700 feet (1,067-2,347 m)
Mexico 4,600 to 5,947 feet (1,400-1,800 m)
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]
  • 2. Bellah, R. Glenn; Hulbert, Lloyd C. 1974. Forest succession on the Republican River floodplain in Clay County, Kansas. Southwestern Naturalist. 19(2): 155-166. [241]
  • 29. Johnston, Barry C. 1987. Plant associations of Region Two: Potential plant communities of Wyoming, South Dakota, Nebraska, Colorado, and Kansas. 4th ed. R2-ECOL-87-2. Lakewood, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Region. 429 p. [3519]
  • 31. Lanner, Ronald M. 1983. Trees of the Great Basin: A natural history. Reno, NV: University of Nevada Press. 215 p. [1401]
  • 35. Medina, Alvin L. 1986. Riparian plant communities of the Fort Bayard watershed in southwestern New Mexico. Southwestern Naturalist. 31(3): 345-359. [1629]
  • 36. Minckley, W. L.; Brown, David E. 1982. Wetlands. In: Brown, David E., ed. Biotic communities of the American Southwest--United States and Mexico. Desert Plants. 4(1-4): 223-287. [8898]
  • 41. Preston, Richard J., Jr. 1948. North American trees. Ames, IA: The Iowa State College Press. 371 p. [1913]
  • 46. Sutton, Richard F.; Johnson, Craig W. 1974. Landscape plants from Utah's mountains. EC-368. Logan, UT: Utah State University, Cooperative Extension Service. 135 p. [49]
  • 51. Weaver, J. E. 1960. Flood plain vegetation of the central Missouri Valley and contacts of woodland with prairie. Ecological Monographs. 30(1): 37-64. [275]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Box Elder is common throughout Illinois; it can be found in all counties (see Distribution Map). Habitats include floodplain forests, open disturbed woodlands, woodland edges, thickets, river banks, fence rows, shallow ditches, roadsides, areas near bridges, and urban waste areas. Sometimes Box Elder colonizes upland habitats as well if they are not too shady. Generally, habitats with a history of some disturbance are preferred.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
42 Bur oak
46 Eastern redcedar
61 River birch - sycamore
62 Silver maple - American elm
63 Cottonwood
87 Sweetgum - yellow poplar
93 Sugarberry - American elm - green ash
94 Sycamore - sweetgum - American elm
95 Black willow
109 Hawthorne
235 Cottonwood - willow
236 Bur oak

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soils and Topography

Boxelder has been found on virtually all types of soils,  from heavy clays to pure sands of the orders Entisols,  Inceptisols, Alfisols, Ultisols, and Mollisols. It is most common  on deep alluvial soils near streams, but it also appears on  upland sites and occasionally on poor, dry sites (11,13).  Through most of its range it grows in areas of little  topographic relief, except for those features associated with  stream valleys. In southern and central Arizona and New Mexico  the species is found up to 2440 m (8,000 ft) (23) and in  Mexico up to 2680 m (8,800 ft) (18), but even at these  elevations it is confined to stream bottoms and wet draws.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate

Boxelder's wide range shows that it grows under a variety  of climatic conditions. Its northward limits are in the extremely  cold areas of the United States and Canada, and planted specimens  have been reported as far north as Fort Simpson in the Canadian  Northwest Territories (2). Although boxelder is most  commonly found on moist soil, it is drought tolerant and is  frequently used in windbreaks and around homesteads throughout  the Plains (21). It has also been known to survive  inundation for as long as 30 days (15).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat & Distribution

Widely cultivated and naturalized in China [native to North America].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Flowering in Boxelder is in early spring and large quantities of seed are produced each year, beginning on trees 8-11 years old. The seeds ripen in autumn, fall continuously from autumn until spring, and are light, large-winged, and widely wind-dispersed. They over-winter and germinate the following spring. Best germination follows stratification for 60-90 days at 33 F.

Boxelder seeds germinate in shade or full sun but seedlings begin to die off after 1-2 years unless openings are formed. Successful seedbeds vary greatly. Trees are fast growing, producing up to 1-inch diameter annual growth for the first 15-20 years. Early growth is best in full sun but tolerant of partial shade. Young trees commonly produce stump and root sprouts. Average longevity is about 60 years; maximum longevity is rarely more than 100.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

Insects that feed on Box Elder include Contarinia negundinis (Box Elder Gall Midge), Boisea trivittatus (Box Elder Bug), Periphyllus negundinis (Box Elder Aphid), several moths, and other insects (see the Insect Table for a listing of these species). Some upland gamebirds and songbirds feed on the seeds, buds, flowers, and/or young shoots; these species include the Ruffed Grouse, Wild Turkey, Prairie Chicken, Evening Grosbeak, Rose-Breasted Grosbeak, Purple Finch, and Passenger Pigeon (now extinct). The seeds are an important source of food to some birds because of their tendency to persist on the branches of Box Elder during the winter; this particularly applies to the Evening Grosbeak. Some mammals also eat the seeds, including the Fox Squirrel, Gray Squirrel, Red Squirrel, Eastern Chipmunk, and White-Footed Mouse. The Cottontail Rabbit and White-Tailed Deer browse on the twigs and leaves. When Box Elder grows near bodies of water, beavers will eat the wood, bark, and branches, while Snapping Turtles sometimes feed on the fallen leaves. This tree also provides nesting habitat for some songbirds, particularly the Cerulean Warbler, which prefers to nest in large specimens of Box Elder in bottomland forests.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower-Visiting Insects of Box Elder in Illinois

Acer negundo (Box Elder)
(this small tree is normally wind-pollinated; information is restricted to bees, which collect pollen; all observations are from Krombein et al.)

Bees (long-tongued)
Apidae (Apinae): Apis mellifera cp fq (Rb)

Bees (short-tongued)
Andrenidae (Andreninae): Andrena forbesii cp (Kr), Andrena imitatrix imitatrix cp (Kr)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Foodplant / parasite
fruitbody of Agrocybe cylindracea parasitises branch of Acer negundo
Other: minor host/prey

Foodplant / saprobe
gregarious, long concealed by epidermis pycnidium of Phomopsis anamorph of Cryptodiaporthe lebiseyi is saprobic on branch of Acer negundo
Remarks: season: 4

Foodplant / saprobe
immersed, multilocular, c. 1mm diam. stroma of Cytospora coelomycetous anamorph of Cytospora annulata is saprobic on dead, locally stained branch of Acer negundo

Foodplant / saprobe
fruitbody of Rigidoporus ulmarius is saprobic on dead, white-rotted stump of Acer negundo

Foodplant / parasite
Sawadaea bicornis parasitises Acer negundo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Forest Cover

Boxelder is most commonly found in association with  bottomland hardwoods. It is an associate species in the following  cover types (Society of American Foresters) (8): 

    Eastern

    42 Bur Oak
  61 River Birch-Sycamore
  62 Silver Maple-American Elm
  63 Cottonwood
  87 Sweetgum-Yellow-poplar
  93 Sugarberry-American Elm-Green Ash
  94 Sycamore-Sweetgum-American Elm
  95 Black willow
  109 Hawthorn

    Western

    235 Cottonwood-Willow
  236 Bur Oak

    Other associates in the eastern United States include red maple  (Acer rubrum), hackberry (Celtis occidentalis), slippery  elm (Ulmus rubra), black walnut (Juglans nigra), basswood  (Tilia americana), black cherry (Prunus serotina),  blackgum (Nyssa sylvatica), pecan (Carya illinoensis),  Nuttall, water, willow, and overcup oak (Quercus  nuttallii, Q. nigra, Q. phellos, and Q. lyrata), persimmon  (Diospyros virginiana), and baldcypress (Taxodium  distichum). In the Plains region, boxelder appears with green  ash (Fraxinus pennsylvanica), bur oak (Quercus  macrocarpa), plains cottonwood (Populus deltoides var.  occidentalis), willow (Salix spp.), and  hackberry. In the Rocky Mountains and the Colorado Plateau,  associates include several species of willow and cottonwood,  netleaf hackberry (Celtis reticulata), and Arizona  sycamore (Platanus wrightii).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Damaging Agents

The chief rot-causing fungi  attacking boxelder are Fomitopsis fraxinus, Perrenniporia  fraxinophilus, Fomes geotropus, Fomitopsis scutellata, Inonotus  glomeratus, and Ustulina vulgaris. Root rots caused  by Rhizoctonia crocorum and Phymatotrichum omnivorum  have been identified on boxelder, but Armillaria mellea  has not been reported on the species, although it is common  on other maples (14).

    Verticillium wilt (Verticillium albo-atrum) is the  only notable killing disease of boxelder. The species is also  susceptible to a stem canker caused by Eutypella parasitica.

    A red stain in the wood of living trees caused by Fusarium  reticulatum var. negundinis apparently is specific to  boxelder. The stain regularly is associated with Cerambycid  beetles and the galleries of other insects, but itself does no  damage to the wood (14).

    Insect damage to boxelder is relatively unimportant, but a  number of leaf-feeding and scale insects and borers attack it  (1). The boxelder bug, Leptocoris trivittatus is  a common associate of boxelder throughout most of its range. The  nymphs feed mainly on pistillate trees in leaves, fruits, and  soft seeds. Although the trees are not greatly damaged, the  insect's habits of invading houses in large numbers with the  onset of cold weather makes it an important pest. The boxelder  aphid, Periphyllus negundinis, and the boxelder gall  midge, Contarinia negundifolia, are also common. Other  leaf feeders include the Asiatic garden beetle, Maladera  castanea, the greenstriped mapleworm, Anisota rubicunda,  a leaf-roller, Archips negundana, and the boxelder  leafroller, Caloptilia negundella. The scale insects  include cottony maple scale, Pulvinaria innumerabilis, and  terrapin scale, Mesolecanium nigrofasciatum. Borers  include the boxelder twig borer, Proteoteras willingana, and  the flatheaded apple tree borer, Chrysobothris femorata.

    Ice and wind damage is common in older trees (11) and  boxelder is quite susceptible to fire and mechanical damage due  to its thin bark.

    Boxelder is highly sensitive to 2,4-D. In the northern Great  Plains, drift from agricultural spraying operations produced  distorted, blighted foliage up to 16 km (10 mi) from the source  (20).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Broad-scale Impacts of Plant Response to Fire

More info for the term: prescribed fire

The Research Project Summary Effects of surface fires in a mixed red and
eastern white pine stand in Michigan
provides information on prescribed
fire and postfire response of plant community species, including boxelder,
that was not available when this species review was written.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the term: root collar

Boxelder most likely reestablishes following fire via wind-dispersed
seeds [31,51]. It may also sprout from the roots, the root collar, or
stump if girdled or top-killed by fire.
  • 31. Lanner, Ronald M. 1983. Trees of the Great Basin: A natural history. Reno, NV: University of Nevada Press. 215 p. [1401]
  • 51. Weaver, J. E. 1960. Flood plain vegetation of the central Missouri Valley and contacts of woodland with prairie. Ecological Monographs. 30(1): 37-64. [275]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the terms: caudex, root crown

off-site colonizer species;seed transported by wind;postfire years 1&2
off-site colonizer species;seed transported by animals;post-fire years 1&2
survivor species; on-site surviving root crown or caudex (possible)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: root crown, tree

Boxelder grows on moist bottomland sites which are seldom subject to
burning. This thin-barked species is injured by fire [50], but how it
regenerates following fire is not known. Boxelder produces large yearly
crops of wind-dispersed seeds which germinate on a wide variety of
soils; this is most likely boxelder's primary fire survival strategy.
This tree also sprouts from the exposed roots, root crown, or stump
following top-killing mechanical damage [1,13,19,38], and it is likely
that boxelder would sprout following fire severe enough to girdle or
top-kill the adult tree.
  • 1. Albertson, F. W.; Weaver, J. E. 1945. Injury and death or recovery of trees in prairie climate. Ecological Monographs. 15: 393-433. [4328]
  • 13. George, Ernest J. 1953. Thirty-one-year results in growing shelterbelts on the Northern Great Plains. Circular No. 924. Washington, DC: U.S. Department of Agriculture. 57 p. [4567]
  • 19. Hansen, Paul L.; Hoffman, George R. 1988. The vegetation of the Grand River/Cedar River, Sioux, and Ashland Districts of the Custer National Forest: a habitat type classification. Gen. Tech. Rep. RM-157. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 68 p. [771]
  • 38. Nix, L. E.; Cox, S. K. 1987. Cherrybark oak enrichment plantings appear successful after seven years in South Carolina bottomlands. In: Phillips, Douglas R., compiler. Proceedings of the fourth biennial southern silvicultural research conference; 1986 November 4-6; Atlanta, GA. General Technical Report SE-42. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 129-132. [4197]
  • 50. Van Dersal, William R. 1938. Native woody plants of the United States, their erosion-control and wildlife values. Washington, DC: U.S. Department of Agriculture. 362 p. [4240]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the terms: climax, codominant

Boxelder occurs in a variety of forest types ranging from early to late
seral, making its successional position difficult to determine. It is
moderately shade tolerant but does not reproduce in its own shade. It
usually establishes under pioneering species such as cottonwood and
willow, particularly in the northern Great Plains [2], and is then
followed by more shade-tolerant, climax species [40]. In Arizona and
New Mexico, boxelder is a dominant or codominant overstory species in
several high-elevation riparian communities [48].
  • 2. Bellah, R. Glenn; Hulbert, Lloyd C. 1974. Forest succession on the Republican River floodplain in Clay County, Kansas. Southwestern Naturalist. 19(2): 155-166. [241]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 48. Szaro, Robert C.; Patton, David R. 1986. Riparian habitat classification in the southwestern United States. Transactions of the 51st North American Wildlife and Natural Resources Conference: 215-221. [3516]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: cover, duff, root collar

Boxelder reproduces both sexually and asexually [41]. Large seed crops
are produced each year [39]. Seeds persist through the winter; they are
dispersed by wind or by birds and squirrels [31,51]. Wind will carry
these winged seeds up to 100 yards across a snow surface [31].

Boxelder establishes by seed under a wide range of conditions:
immediately after disturbance on moist disturbed soil [40], along
riverbanks [51], and in areas with heavy cover and medium to heavy
competition [28]. In southern Illinois, Hosner and Minckler [28]
reported reproduction of boxelder on areas with light, medium, and heavy
duff:

light duff med duff heavy duff
(over 0.5 in) (0.5 to 2 in) (over 2 in)

No. of 1- and
2-yr-old seedlings 121 90 35

Vegetative reproduction is also common on damaged plants of this
species. New shoots will appear on exposed or injured roots [50].
After the extreme drought condition of the 1930's in the Great Plains,
during which nearly all boxelder trees in shelterbelts 30 years or older
died back to the ground, many trees recovered by producing root sprouts,
forming a dense hedge or undergrowth [1]. In shelterbelts of the
northern Great Plains, boxelder has a dense growing habit resulting from
the plant suckering at the root collar [13]. Seven years after timber
harvest in a South Carolina bottomland, sprouts from boxelder stumps
greater than 20 inches (51 cm) in diameter were reported to be dying or
losing vigor [38]. Although this species will produce abundant sprouts
after disturbance, the primary method of reproduction is through seed,
due to the quantity produced each year and the facility of its
distribution.
  • 1. Albertson, F. W.; Weaver, J. E. 1945. Injury and death or recovery of trees in prairie climate. Ecological Monographs. 15: 393-433. [4328]
  • 13. George, Ernest J. 1953. Thirty-one-year results in growing shelterbelts on the Northern Great Plains. Circular No. 924. Washington, DC: U.S. Department of Agriculture. 57 p. [4567]
  • 28. Hosner, John F.; Minckler, L. S. 1960. Hardwood reproduction in the river bottoms of southern Illinois. Forest Science. 6(1): 67-77. [3738]
  • 31. Lanner, Ronald M. 1983. Trees of the Great Basin: A natural history. Reno, NV: University of Nevada Press. 215 p. [1401]
  • 38. Nix, L. E.; Cox, S. K. 1987. Cherrybark oak enrichment plantings appear successful after seven years in South Carolina bottomlands. In: Phillips, Douglas R., compiler. Proceedings of the fourth biennial southern silvicultural research conference; 1986 November 4-6; Atlanta, GA. General Technical Report SE-42. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 129-132. [4197]
  • 39. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 41. Preston, Richard J., Jr. 1948. North American trees. Ames, IA: The Iowa State College Press. 371 p. [1913]
  • 50. Van Dersal, William R. 1938. Native woody plants of the United States, their erosion-control and wildlife values. Washington, DC: U.S. Department of Agriculture. 362 p. [4240]
  • 51. Weaver, J. E. 1960. Flood plain vegetation of the central Missouri Valley and contacts of woodland with prairie. Ecological Monographs. 30(1): 37-64. [275]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the term: phanerophyte

Phanerophyte

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

Van Dersal reports that this thin-barked species is injured by fire
[50].
  • 50. Van Dersal, William R. 1938. Native woody plants of the United States, their erosion-control and wildlife values. Washington, DC: U.S. Department of Agriculture. 362 p. [4240]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rooting Habit

Boxelder usually develops a  shallow, fibrous root system. On deep soils it may form a  short taproot with strong laterals (11).

    Reaction to Competition- In the area of  its best development, the lower Ohio and Mississippi River  valleys, boxelder usually follows the pioneer species of  cottonwood and willow in colonizing new ground in alluvial  bottoms. In some instances it is a pioneer species in the  invasion of old fields (16). Boxelder may persist into  the oak-hickory type but then begins to be eliminated, probably  due to shading (18). The species is generally classed as  tolerant of shade, although less so than the other soft maples  (13).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

Boxelder flowers from March through May with or before the appearance of
the leaves. The fruit, a winged samara, ripens from September through
October and is dispersed from September through March [39,50,53].
Boxelder's leaves turn a dull yellow color in the autumn and drop
throughout the fall and winter [40].
  • 39. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 50. Van Dersal, William R. 1938. Native woody plants of the United States, their erosion-control and wildlife values. Washington, DC: U.S. Department of Agriculture. 362 p. [4240]
  • 53. Williams, Robert D.; Hanks, Sidney H. 1976. Hardwood nurseryman's guide. Agric. Handb. 473. Washington, DC: U.S. Department of Agriculture, Forest Service. 78 p. [4182]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Vegetative Reproduction

Reproduction by stump and root  sprouts is common in boxelder from young, vigorous trees (8,18).  Reports on propagation by cuttings indicate that best results  are obtained from cuttings taken during the period of transition  from softwood to greenwood and treated with an 8,000 ppm IBA-talc  mixture (7). European nurserymen propagate some ornamental  cultivars of boxelder using side grafts, whip and tongue grafts,  or chip budding (7).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seed Production and Dissemination

Seed crops are  produced each year on individual boxelder trees beginning at 8 to  11 years of age. The samaras are borne on drooping racemes and  average 29 500/kg (13,400/lb) (26). Ripening takes place  from August to October and seeds are wind distributed  continuously until spring. This extended period provides a  variety of germination sites, moisture, and temperature  combinations and may account for the prolific reproduction from  seed that is common for the species (11).

    Seedling Development- Boxelder is capable of  establishing itself on a variety of seedbeds. On southern  Illinois bottom lands, it is among the most abundant species  seeding in under cottonwood-willow and "soft" hardwood  stands and invading old fields. On these sites, overstory density  is apparently not a factor in early germination and survival, but  seedlings begin to die off after 1 or 2 years unless openings are  provided. The 1- and 2-year-old boxelder seedlings are also  abundant in areas of ground vegetation ranging from light to  heavy and in hardwood litter as much as 5 cm (2 in) deep (16).

    Methods of collecting, handling, storing, and testing boxelder  seeds have been described (3,4,26). Germination is  epigeal.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering and Fruiting

Boxelder is dioecious with  imperfect flowers, although perfect flowers that appeared to be  functional have been reported (12). The staminate flowers  are fascicled, the pistillate flowers are drooping racemes and  are wind pollinated (21,23). Flowers appear with or  before the leaves from March to May, depending on the geographic  location (13,28).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Growth and Yield

Boxelder is a small to  medium-size tree reaching 15 to 23 m (50 to 75 ft) in height and  60 to 120 cm (24 to 48 in) in d.b.h. The species is short-lived,  attaining an average age of 60 years but rarely 100 years. Growth  during the first 15 to 20 years is very rapid and may be as much  as 2.5 cm (1 in) a year in d.b.h. (11). Poor sites bring  a corresponding reduction in growth. In western Minnesota  windbreaks, diameter growth averaged less than 5 mm (0.2 in) per  year and height growth averaged less than 0.37 m (1.2 ft) per  year during the first 13 years after planting (25). Boxelder  typically forms a short, tapering bole and bushy, spreading  crown.

    Because boxelder usually appears in mixed stands and has limited  commercial value, no information is available about its potential  yield. Equations are available, however, to predict volume of  boxelder stems, and green and dry weights of stems, limbs, and  leaves (24). After trees reach 15 cm (5.9 in) in d.b.h.,  the proportion of aboveground green components is relatively  constant, with bole wood, 63 percent; bole bark, 8 percent;  limbs, 22 percent; and leaves, 7 percent.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Population differences in boxelder have been noted in  response to photoperiod (6,28), in seed germination and  stratification requirements (29), seed weight (30),  tracheid length (31), frost tolerance (5), and in  chlorophyll levels (10).

    Some 8 to 14 varieties and forms have been described for boxelder,  several relating to variegated patterns of the foliage or some  other morphological character (2,17,21,23,28). At least  two varieties appear to be confined to a definite geographic  range: var. arizonicum Sarg. to central and southern  Arizona and New Mexico and var. californicum (Torr. and  Gray) Sarg. to the Central Valley, Coast Range, and San  Bernardino Mountains of California (23).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Acer negundo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTCGGTGCCATTGCAGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTGATAGGTGCACCTGACATGGCATTTCCGCGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCAGGAGGAGCAGTTGATTCAGCAATTTCTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCCACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCCGCTGGAGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acer negundo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status, such as, state noxious status, and wetland indicator values.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the term: tree

Boxelder is susceptible to mechanical damage by livestock in northern
Great Plains wooded draws [4]. This tree is also easily storm damaged;
its weak branches often break off in the wind, but the trunk is wind
firm [47].

Boxelder is easily injured by heart rot, fire, and insects. It is often
infested with boxelder bugs which feed on the tree but rarely kill it
[40].
  • 4. Butler, Jack; Goetz, Harold. 1984. Influence of livestock on the composition and structure of green ash communities in the Northern Great Plains. In: Noble, Daniel L.; Winokur, Robert P., eds. Wooded draws: characteristics and values for the Northern Great Plains: Symposium proceedings; 1984 June 12-13; Rapid City, SD. Great Plains Agricultural Council Publication No. 111. Rapid City, SD: South Dakota School of Mines and Technology, Biology Department: 44-49. [572]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 47. Szaro, Robert C. 1989. Riparian forest and scrubland community types of Arizona and New Mexico. Desert Plants. 9(3-4): 70-138. [604]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These species are introduced in Switzerland.
  • Aeschimann, D. & C. Heitz. 2005. Synonymie-Index der Schweizer Flora und der angrenzenden Gebiete (SISF). 2te Auflage. Documenta Floristicae Helvetiae N° 2. Genève.   http://www.crsf.ch/ External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Info Flora (CRSF/ZDSF) & Autoren 2005

Supplier: Name It's Source (profile not public)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

Boxelder is available at most nurseries within it distribution.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Boxelder is tolerant to stressful sites and requires little special care, but it is relatively short-lived and the branches of older trees are susceptible to ice and wind damage. Boxelder is highly sensitive to 2,4-D and also is susceptible to fire and mechanical damage because of its thin bark.

The boxelder bug is a common associate of boxelder

throughout most of its range. The nymphs feed mainly on female (pistillate) trees in leaves, fruits, and soft seeds. The trees are not greatly damaged but the insects sometimes invade human habitation in large numbers with the onset of cold weather.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

More info for the term: tree

Boxelder, first cultivated in 1688 [39], is often held in low regard as
an ornamental tree in cities. Its limbs are brittle and break easily;
its trunk is susceptible to rot and infested with boxelder bugs, which
make their way into houses with the arrival of cold weather. The leaves
turn a dull yellow and fall untidily over a long period, as do the
winged seeds, giving this species the reputation of being a "dirty tree"
[27,31,52]. However, because of its fast growth and drought and cold
hardiness, boxelder is popular in rural communities for street and
ornamental plantings; and for shelterbelts.

Boxelder's abundant sap contains a large proportion of sugar as well as
mucilaginous and demulcent properties, and can be made into a pleasant
beverage [22]. The Plains Indians used the sap as a source of syrup,
and it is still used today, but the product is not as sweet as sugar
maple syrup [31].
  • 52. Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry C., eds. 1987. A Utah flora. Great Basin Naturalist Memoir No. 9. Provo, UT: Brigham Young University. 894 p. [2944]
  • 27. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 22. Havard, V. 1885. Report on the flora of western and southern Texas. Proceedings of the United States National Museum. 8(29): 449-533. [5067]
  • 31. Lanner, Ronald M. 1983. Trees of the Great Basin: A natural history. Reno, NV: University of Nevada Press. 215 p. [1401]
  • 39. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

Growth of boxelder is poor on saline, sodic, sodic-saline, and most
acidic soils; it is not recommended for use in rehabilitation of
disturbed sites. This tree's potential for erosion control and for
long-term revegetation is low to medium [9].

In California, Arizona, and parts of Nevada and New Mexico, boxelder is
one of many native species used for revegetating flood control basins to
provide quality wildlife habitat [13]. In the southeastern United
States where soil moisture (or inundation) is likely to be excessive for
several weeks at a time, boxelder is one of the favored flood-tolerant
species recommended for recreation plantings.

Boxelder is propagated by seed. Guides for seed collection, treatment,
and cultivation are available [7,39,44,53].
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]
  • 7. Cram, W. H. 1983. Maturity and viability of boxelder maple seeds. Tree Planter's Notes. 34(2): 36-37. [5007]
  • 13. George, Ernest J. 1953. Thirty-one-year results in growing shelterbelts on the Northern Great Plains. Circular No. 924. Washington, DC: U.S. Department of Agriculture. 57 p. [4567]
  • 39. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 44. Roe, Eugene I. 1941. Effect of temperature on seed germination. Journal of Forestry. 39: 413-414. [2019]
  • 53. Williams, Robert D.; Hanks, Sidney H. 1976. Hardwood nurseryman's guide. Agric. Handb. 473. Washington, DC: U.S. Department of Agriculture, Forest Service. 78 p. [4182]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Value

More info for the term: cover

Boxelder provides valuable cover for wildlife and livestock, especially
in the Great Plains region where quality cover is often lacking. The
degree to which this species provides environmental protection during
one or more seasons for wildlife species is as follows [9]:

UT CO WY MT ND

Elk ---- poor ---- poor ----
Mule deer fair ---- good good fair
White-tailed deer ---- ---- good good good
Pronghorn poor ---- poor ---- poor
Upland game birds fair ---- good good ----
Waterfowl poor ---- poor ---- ----
Small nongame birds good good good good ----
Small mammals fair good fair fair ----
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

Riparian boxelder communities provide important habitat for many
wildlife species and protect livestock from temperature extremes in
summer and winter. Many species of birds and squirrels feed on the
seeds of boxelder [23,40,46]. Mule deer and white-tailed deer use it in
the fall as a browse species of secondary importance [37]. This tree
may be poisonous to livestock [9].
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]
  • 23. Hehnke, Merlin; Stone, Charles P. 1979. Value of riparian vegetation to avian populations along the Sacramento River Sy. In: Johnson, R. Roy; McCormick, J. Frank, technical coordinators. Strategies for protection and management of floodplain wetlands & other riparian ecosystems: Proc. of the symposium; 1978 December 11-13; Callaway Gardens, GA. General Technical Report WO-12. Washington, DC: U.S. Department of Agriculture, Forest Service: 228-235. [4363]
  • 37. Nelson, Jack Raymond. 1961. Composition and structure of the principal woody vegetation types in the North Dakota Badlands. Fargo, ND: North Dakota State University. 195 p. Thesis. [161]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 46. Sutton, Richard F.; Johnson, Craig W. 1974. Landscape plants from Utah's mountains. EC-368. Logan, UT: Utah State University, Cooperative Extension Service. 135 p. [49]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

More info for the term: fuel

Boxelder is not a desired timber species because its wood is light,
soft, close grained, and low in strength [27,41,45]. The wood is used
locally for boxes and rough construction [27], and is used occasionally
for cheap furniture and woodenware. Boxelder was once used for posts,
fencing, and fuel but the soft, spongy wood generally makes poor
firewood [40].
  • 27. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 40. Patterson, Rich. 1985. The humblest maple. American Forests. 91(5): 46-48. [5005]
  • 41. Preston, Richard J., Jr. 1948. North American trees. Ames, IA: The Iowa State College Press. 371 p. [1913]
  • 45. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nutritional Value

The nutritional value of boxelder is low for livestock, with fair energy
value, poor protein value, and suspected toxicity [9].
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

Palatability of boxelder has been rated as follows [9]:

UT WY MT ND

Cattle poor poor poor poor
Sheep poor poor poor poor
Horses poor poor poor poor
Elk poor fair ---- ----
Mule deer poor good poor poor
White-tailed deer ---- fair poor poor
Pronghorn poor poor ---- poor
Upland game birds fair fair ---- ----
Waterfowl poor fair ---- ----
Small nongame birds fair fair fair ----
Small mammals fair fair ---- ----
  • 9. Dittberner, Phillip L.; Olson, Michael R. 1983. The plant information network (PIN) data base: Colorado, Montana, North Dakota, Utah, and Wyoming. FWS/OBS-83/86. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 786 p. [806]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Special Uses

Because of its drought and cold resistance, boxelder has  been widely planted in the Great Plains and at lower elevations  in the West as a street tree and in windbreaks. Although the  species is not an ideal ornamental, being "trashy,"  poorly formed, and short-lived, numerous ornamental cultivars of  boxelder are propagated in Europe (7). Its fibrous root system  and prolific seeding habit have led to its use in erosion control  in some parts of the world (32).

    Seeds and other portions of boxelder are utilized by many species  of birds and mammals as food (19). Because of the species  delayed seeding habit, some seeds are available throughout most  of the winter. The sap of boxelder has been used to a limited  extent for syrup (9).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Ronald P. Overton

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

The wood of Boxelder is light, soft and weak, and of low commercial value. It is used for pulp and rough lumber, usually mixed with other bottomland species, and has been used for boxes and crates, low-quality furniture, and interior finishing.

Boxelder produces sap high in sugar content and can be used to produce syrup sometimes called "mountain molasses." Native Americans used the cambium for food, boiled down the sap for syrup and candy, and made a tea from the inner bark to induce vomiting. The new branches were used to make charcoal for ceremonial painting.

The trees are useful for quick growth in naturalized riparian plantings, but they are short-lived and disease-prone. The species was once planted in the U.S. as a street tree and ornamental cultivars have been developed (including forms with red fall color, variously variegated leaves, and without seeds). It is not now commonly planted in the U.S., where its removal is sometimes more of a challenge. The quick growth of this species, however, and its tolerance to urban conditions, allows it to contribute to shade and rapid re-greening in disturbed city sites, particularly in the Great Plains and the West, because of its drought and cold tolerance. Boxelder can be used temporarily until replaced by slower growing but longer lasting trees.

Boxelder was once widely planted in shelterbelts in the Great Plains to reduce wind erosion and dust storms, but these shelterbelts have largely been removed. Its fibrous root system and prolific seeding habit make it valuable for erosion control in some parts of the world. The seeds are important winter food for birds and small mammals, deer browse young plants.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acer negundo

Acer negundo is a species of maple native to North America. Box elder, boxelder maple, and maple ash are its most common names in the United States.

Contents

Common names [edit]

Other variant names, some of which are regional, include: Ash Maple, Ash-leaf Maple, Black Ash, California Boxelder, Cutleaf Maple, Cut-leaved Maple, Negundo Maple, Red River Maple, Stinking Ash, Sugar Ash, Three-leaved Maple, and Western Boxelder. In Canada it is commonly known as Manitoba Maple and occasionally as Elf Maple.[3] In Russia it is called American Maple (Russian: американский клён) as well as Ash-leaf Maple (Russian: клён ясенелистный).

Description [edit]

Acer negundo is a small, usually fast-growing and fairly short-lived tree that grows up to 10–25 metres (33–82 ft) tall, with a trunk diameter of 30–50 centimetres (12–20 in), rarely up to 1 metre (3.3 ft) diameter. It often has several trunks and can form impenetrable thickets.[4]

The shoots are green, often with a whitish to pink or violet waxy coating when young. Branches are smooth, somewhat brittle, and tend to retain a fresh green colour rather than forming a bark of dead, protective tissue. The bark on its trunks is pale gray or light brown, deeply cleft into broad ridges, and scaly.[5]

Unlike most other maples (which usually have simple, palmately lobed leaves), Acer negundo has pinnately compound leaves that usually have three to seven leaflets. Simple leaves are also occasionally present; technically, these are single-leaflet compound leaves. Although some other maples (such as A. griseum, Acer mandshuricum and the closely related A. cissifolium) have trifoliate leaves, only A. negundo regularly displays more than three leaflets.

The leaflets are about 5–10 centimetres (2.0–3.9 in) long and 3–7 centimetres (1.2–2.8 in) wide with slightly serrate margins. Leafs have a translucent light green colour and turn yellow in the fall.

The flowers are small and appear in early spring on drooping racemes 10–20 centimetres (3.9–7.9 in) long. The seeds are paired samaras, each seed slender, 1–2 centimetres (0.39–0.79 in) long, with a 2–3 centimetres (0.79–1.2 in) incurved wing; they drop in autumn or they may persist through winter. Seeds are usually both prolific and fertile.

Unlike most other maples, A. negundo is fully dioecious and both a "male" and "female" tree are needed for either to reproduce.

  • Winter buds: Terminal buds acute, an eighth of an inch long. Lateral buds obtuse. The inner scales enlarge when spring growth begins and often become an inch long before they fall.
  • Flowers: April, before the leaves, yellow green; staminate flowers in clusters on slender hairy pedicels one and a half to two inches long. Pistillate flowers in narrow drooping racemes.
  • Calyx: Yellow green; staminate flowers campanulate, five-lobed, hairy. Pistillate flowers smaller, five-parted; disk rudimentary.
  • Corolla: Wanting.
  • Stamens: Four to six, exserted; filaments slender, hairy; anthers linear, connective pointed.
  • Pistil: Ovary hairy, borne on disk, partly enclosed by calyx, two-celled, wing-margined. Styles separate at base into two stigmatic lobes.
  • Fruit: Maple keys, full size in early summer. Borne in drooping racemes, pedicels one to two inches long. Key an inch and a half to two inches long, nutlets diverging, wings straight or incurved. September. Seed half an inch long. Cotyledons, thin, narrow.[5]

Taxonomy [edit]

Indicative of its familiarity to many people over a large geographic range, A. negundo has numerous common names.

The names "Box Elder" and "Boxelder Maple" are based upon the similarity of its whitish wood to that of boxwood and the similarity of its pinnately compound leaves with those of some species of elder.[6] This is the only North American maple with compound leaves.[5]

Other common names are based upon this maple's similarity to ash, its preferred environment, its sugary sap, a description of its leaves, its binomial name, and so on. These names include (but are not limited to) Ash-, Cut-, or Three-leaf (or -leaved) Maple; Ash Maple; Sugar Ash; Negundo Maple; and River Maple.[7]

Common names may also designate a particular subspecies. For example, a common name for A. negundo subsp. interius may be preceded by "Inland" (as in "Inland Boxelder Maple"). A common name for A. negundo subsp. californicum may be preceded by "California" or "Western".

Subspecies [edit]

A. negundo leaves and seeds

Acer negundo is often discussed as comprising three subspecies, each of which was originally described as a separate species. These are:

  • A. negundo subsp. negundo is the main variety and the type to which characteristics described in the article most universally apply. Its natural range is from the Atlantic Coast to the Rocky Mountains.[4]
  • A. negundo subsp. interius has more leaf serration than the main species and a more matte leaf surface. As the name interus indicates, its natural range of Saskatchewan to New Mexico is sandwiched between that of the other two subspecies.[4]
  • A. negundo subsp. californicum has larger leaves than the main species. Leaves also have a velvety texture which is essential to distinguish it from A. negundo subsp. negundo. It is found in parts of California and Arizona.[4]

Some authors further subdivide subsp. negundo into a number of regional varieties but these intergrade and their maintenance as distinct taxa is disputed by many. Even the differences between recognized subspecies are probably a matter of gradient speciation

Finally, note that a few botanists treat Boxelder Maple as its own distinct genus (Negundo aceroides) but this is not widely accepted.

Distribution [edit]

As noted, varieties thrive across the United States and Canada. It may also be found as far south as Guatemala

Ecology [edit]

Boxelder, Manitoba Maple. Tree. ND, USA.

This species prefers bright sunlight. It often grows on flood plains and other disturbed areas with ample water supply, such as riparian habitats. Human influence has greatly favoured this species; it grows around houses and in hedges, as well as on disturbed ground and vacant lots.

Several birds and some squirrels feed on the seeds. The evening grosbeak uses them extensively. The Maple Bug (also known as the Boxelder Bug) lays its eggs on all maples, but prefers this species.

Cultivation [edit]

Although its weak wood, irregular form, and prolific seeding might make it seem like a poor choice for a landscape tree, A. negundo is one of the most common maples in cultivation and many interesting cultivars have been developed, including:[4]

  • 'Auratum' - yellowish leaves with smooth undersides
  • 'Aureomarginatum' - creamy yellow leaf margins
  • 'Baron' - Hardier & seedless variety
  • 'Elegans' - distinctively convex leaves
  • 'Flamingo' - pink and white variegation (very popular)
  • 'Pendulum' - with weeping branches.
  • 'Variegatum' - creamy white leaf margins
  • 'Violaceum' - younger shoots and branches have bluish colour

Although native to North America, it is considered an invasive species in some areas of that continent. It can quickly colonize both cultivated and uncultivated areas and it has become naturalized in eastern China.[4] The range is therefore expanding both in North America and elsewhere. It can also be found in some of the cooler areas of the Australian continent where it is listed as a pest invasive species. It has also naturalized in the Vistula valley in Poland.

Uses [edit]

Although its light, close-grained, soft wood is considered undesirable for most uses, this tree has been considered as a commercial source of wood fiber, for use in fiberboard.

There is some commercial use of the tree for various decorative applications, such as turned items (bowls, stem-ware, pens). Primarily burl wood and injured wood, where the primary reason is this wood's reaction to injury, where the injured wood develops a red stain.

Use by Native Americans [edit]

The Navajo use the wood make tubes for bellows.[8] The Cheyenne burn the wood as incense for making spiritual medicines,[9] and during Sun Dance ceremonies.[9] They also mix the boiled sap with shavings from the inner sides of animal hides and eat them as candy.[9][10]

The Meskwaki use a decoction of the inner bark as an emetic[11] and the Ojibwa use an infusion of the inner bark for the same purpose.[12] The Chiricahua and Mescalero Apache dry scrapings of the inner bark and keep it as winter food, and they also boil the inner bark until sugar crystallizes out of it.[13] The Dakota also use the sap to make sugar,[14] as do the Omaha,[15][16] the Pawnee,[16] the Ponca,[16] the Winnebago[16] and the indigenous people of Montana, who also freeze the sap and use it as a syrup[9] The Ojibwa mix the sap with that of the sugar maple and drink it as a beverage.[17]

The Cheyenne also use the wood to make bowls[18] and to cook meat.[9][10] The Keres make the twigs into prayer sticks.[19] The native peoples of Montana also use large trunk burls or knots to make bowls, dishes, drums, and pipe stems.[9]

The Dakota and the Omaha[16][20] make the wood into charcoal, which is used in ceremonial painting and tattooing.[14][16]

The Kiowa burn the wood from the negundo subspecies in the altar fire during the peyote ceremony,[21] and the Sioux boil the sap of this variety in the spring to make sugar.[22]

The interius subspecies is used by Cree to make sugar from the sap,[23] and the Tewa use the twigs as pipe stems.[24]

Archaeological artifacts [edit]

Acer negundo was identified in 1959 as the material used in the oldest extant flutes from the Americas that were made of wood. These early artifacts, excavated by Earl H. Morris in 1931 in the Prayer Rock district of present-day Northeastern Arizona, have been dated to 620-670 CE.[25]

The style of these flutes, now known as Anasazi flutes, uses an open tube and a splitting edge at one end. This design pre-dates the earliest known Native American Flute (which use a two-chambered design) by approximately 1,200 years.

Notes [edit]

  1. ^ "Acer negundo L.". NatureServe Explorer. Retrieved 2007-07-03. 
  2. ^ Stevens, P. F. (2001 onwards). Angiosperm Phylogeny Website. Version 9, June 2008 [and more or less continuously updated since]. http://www.mobot.org/MOBOT/research/APweb/.
  3. ^ Community trees of the Prairie provinces - Canadian Forest Service
  4. ^ a b c d e f van Gelderen, C.J. & van Gelderen, D.M. (1999). Maples for Gardens: A Color Encyclopedia.
  5. ^ a b c Keeler, H. L. (1900). Our Native Trees and How to Identify Them. New York: Charles Scriber's Sons. pp. 85–87. 
  6. ^ DePauw University
  7. ^ Acer spp. Aceraceae Note that some of the common names given in this reference are questionable. "Stinking Ash" and "Black Ash" typically refer to Ptelea trifoliata and Fraxinus nigra, respectively. This reference is retained as an example of the confusion which arises when plants such as A. negundo are discussed by other than their scientific names.
  8. ^ Elmore, Francis H. 1944 Ethnobotany of the Navajo. Sante Fe, NM. School of American Research (p. 62)
  9. ^ a b c d e f Hart, Jeff 1992 Montana Native Plants and Early Peoples. Helena. Montana Historical Society Press (p. 4)
  10. ^ a b Hart, Jeffrey A. 1981 The Ethnobotany of the Northern Cheyenne Indians of Montana. Journal of Ethnopharmacology 4:1-55 (p. 13)
  11. ^ Smith, Huron H. 1928 Ethnobotany of the Meskwaki Indians. Bulletin of the Public Museum of the City of Milwaukee 4:175-326 (p. 200)
  12. ^ Smith, Huron H. 1932 Ethnobotany of the Ojibwe Indians. Bulletin of the Public Museum of Milwaukee 4:327-525 (p. 353)
  13. ^ Castetter, Edward F. and M. E. Opler 1936 Ethnobiological Studies in the American Southwest III. The Ethnobiology of the Chiricahua and Mescalero Apache. University of New Mexico Bulletin 4(5):1-63 (p. 44)
  14. ^ a b Gilmore, Melvin R. 1913 Some Native Nebraska Plants With Their Uses by the Dakota. Collections of the Nebraska State Historical Society 17:358-70 (p. 366)
  15. ^ Gilmore, Melvin R. 1913 A Study in the Ethnobotany of the Omaha Indians. Nebraska State Historical Society Collections 17:314-57. (p. 329)
  16. ^ a b c d e f Gilmore, Melvin R. 1919 Uses of Plants by the Indians of the Missouri River Region. SI-BAE Annual Report #33 (p. 101)
  17. ^ Smith, Huron H. 1932 Ethnobotany of the Ojibwe Indians. Bulletin of the Public Museum of Milwaukee 4:327-525 (p. 394)
  18. ^ Hart, Jeffrey A. 1981 The Ethnobotany of the Northern Cheyenne Indians of Montana. Journal of Ethnopharmacology 4:1-55 (p. 46)
  19. ^ Swank, George R. 1932 The Ethnobotany of the Acoma and Laguna Indians. University of New Mexico, M.A. Thesis (p. 24)
  20. ^ Gilmore, Melvin R. 1913 A Study in the Ethnobotany of the Omaha Indians. Nebraska State Historical Society Collections 17:314-57. (p. 336)
  21. ^ Vestal, Paul A. and Richard Evans Schultes 1939 The Economic Botany of the Kiowa Indians. Cambridge MA. Botanical Museum of Harvard University (p. 40)
  22. ^ Blankinship, J. W. 1905 Native Economic Plants of Montana. Bozeman. Montana Agricultural College Experimental Station, Bulletin 56 (p. 16)
  23. ^ Johnston, Alex 1987 Plants and the Blackfoot. Lethbridge, Alberta. Lethbridge Historical Society (p. 44)
  24. ^ Robbins, W.W., J.P. Harrington and B. Freire-Marreco 1916 Ethnobotany of the Tewa Indians. SI-BAE Bulletin #55 (p. 38)
  25. ^ Clint Goss (2011). "Anasazi Flutes from the Broken Flute Cave". Retrieved 20110-10-18. 

Bibliography [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Notes

Comments

This North American species is cultivated in Bagh-i-Jinnah, Lahore and according to Parker, l.c., “It does well in the plains.”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!