Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Aceraceae -- Maple family

    Richard M. Godman, Harry W. Yawney, and Carl H. Tubbs

    Sugar maple (Acer saccharum), sometimes called hard maple  or rock maple, is one of the largest and more important of the  hardwoods. It grows on approximately 12.5 million hectares (31  million acres) or 9 percent of the hardwood land and has a net  volume of about 130 million m3 (26 billion fbm) or 6 percent of  the hardwood sawtimber volume in the United States. The greatest  commercial volumes are presently in Michigan, New York, Maine,  Wisconsin, and Pennsylvania (53). In most regions, both the  sawtimber and growing stock volumes are increasing, with  increased production of saw logs, pulpwood, and more recently,  firewood.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Acer saccharum, sugar maple, is a large tree native to North America; it is the official State Tree of New York, Vermont, West Virginia, and Wisconsin (USNA 2011). It has a dense, spreading crown, 25-40 m tall. The leaves are deciduous, opposite, 5-11 cm long and wide, with 5 shallow, blunt or short-pointed lobes, edges coarsely toothed, dark green in summer, turning intensely red, orange, or yellow in fall. Most trees are dioecious (either male or female) but some individuals are monoecious, bearing both male and female flowers. The fruits are samaras (winged nutlets) that occur in pairs.

Maples are classified in their own family, Aceraceae, or in the larger group, Sapindaceae. See Systematics and Taxonomy.

Maples were an important sweetener and source of winter nutrition for North American natives and early European settlers (see Uses in full entry). Production of maple syrup is a multimillion dollar industry in the U.S. and Canada (NASS 2011).

Sugar maple is widely planted as an ornamental or shade tree. Many cultivars have been developed, with variations in crown shape, height, fall color, leaf shape, and temperature tolerance. It does not tolerate street salt or soil compaction in urban plantings, so is no longer commonly planted as a street tree. Sugar maple is an important timber tree (see Uses).

Sugar maple in North America is sometimes confused with Norway maple (Acer platanoides), an introduced European species that looks similar, but is more resistant to pollution and has fewer insect pests. Norway maple has broader leaves with drooping lobes, and sap from a broken petiole is milky. Norway maple is considered invasive in 20 Northeastern U.S. states (USFS 2011), and in eastern Canada.

Sugar maple is widespread and dominant or codominant in many northern hardwood and mixed mesophytic forests of the eastern United States. It occurs in rich, mesic (moist) woods but also grows in drier upland woods. In 2002, it was one of the 10 most abundant tree species in the U.S. (FIA 2011). Sugar maple is declining in some northeastern forests (such as the Alleghenies), due to its sensitivity to acid rain and other pollution; it may be replaced by opportunistic species in frequently cut or highly disturbed forests (Wikipedia, 2011). In other regions, sugar maple has increased, possibly due to fire suppression (Potter-Witter and Lacksen 1993; MapleInfo.org 2011).

Animals that feed on sugar maple seeds, buds, twigs, and leaves include white-tailed deer, moose, snowshoe hare, red, gray, and flying squirrels, and numerous lepidopteran larvae and aphids. Porcupines consume the bark and can girdle the upper stem. Songbirds and woodpeckers, and cavity nesters nest in sugar maple. The flowers appear to be wind-pollinated, but the early-produced pollen is important for Apis mellifera (honeybees) and other insects.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Jacqueline Courteau, modified from USDA PLANTS Database.

Supplier: Jacqueline Courteau

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

This tree is 60-100' tall at maturity and its trunk is 2-3½' across. In relatively open areas, the densely branched crown is globoid to ovoid in shape. Saplings that are growing in dense shade, however, have a narrow open crown with only a few ascending branches. Trunk bark is gray to gray-brown and it is covered with relatively flat irregular plates. These plates have a rough texture. Branch bark is gray and more smooth, while twigs are brown and glabrous with scattered white lenticels (air pores). Non-woody young shoots are light green and glabrous. Pairs of opposite leaves occur along the twigs and young shoots. Individual leaves are 3-5' long and similarly across; each leaf has 3-5 palmate lobes and an orbicular outline. The tips of these lobes are pointed, while their sinuses are rounded; the sides of the terminal lobe are more or less parallel. The margin of each leaf  is often slightly undulate and it has a few large teeth that are dentate. The upper leaf surface is dark green and glabrous, while the lower surface is pale to medium green, glabrous (or nearly so), and sometimes slightly glaucous. However, there is a variety of Sugar Maple (var. schneckii) in southern Illinois and areas further south that has leaves with softly pubescent undersides. The slender petioles are 2½-4' long, light green, and glabrous; less often, they may be pubescent or slightly red. Sugar Maple is either dioecious or monoecious, producing separate male and female flowers on the same or different trees. Male flowers are produced in drooping umbels or sparingly branched corymbs about 3-4' long. Individual male flowers are about 1/8' long, consisting of a yellowish green calyx with 5 teeth and a variable number of exerted stamens (usually about 6-8). Female flowers are also produced in drooping umbels or sparingly branched corymbs, but they are shorter (about 1-2' long). Individual female flowers are about 1/8' long, consisting of a yellowish green calyx with 5 teeth and a 2-celled ovary with a divided style. Both male and female flowers can occur in the same inflorescence. The long slender pedicels of both male and female flowers are quite hairy. The flowers bloom during mid- to late spring as the leaves emerge (which are yellowish green at this time of year). Cross-pollination occurs by the wind during a 1-2 week period. Fertile female flowers are replaced by paired samaras that become mature during the fall. The paired samaras form a 60º to 90º angle with each other. Individual samaras are about 1' long, consisting of a single-seeded head with a membranous wing; they are distributed by the wind. The woody root system consists of much-branched lateral roots that are relatively shallow. During the autumn, the deciduous leaves assume brilliant shades of yellow, orange, or red.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

        General: Maple Family (Aceraceae). A native tree with a dense, spreading crown, to 25-37(-40) m in height; bark light gray to gray-brown, rough, deeply furrowed, and darker with age. The leaves are deciduous, opposite, long-petioled, blades 5-11 cm long and about as wide, with 5 shallow, blunt or short-pointed lobes, edges coarsely toothed, dark green and glabrous above, whitish and more or less hairy below, turning intensely red, orange, or yellow in fall. The flowers are small, greenish-yellow, in long-stalked, drooping clusters or racemes, each cluster with 8 to 14 flowers. Most trees are either male or female (the species is essentially dioecious), but both kinds of flowers occur on some trees (technically monoecious), sometimes segregated on different branches. The fruits are winged nutlets (samaras) in a pair, 2-2.5 cm long, clustered on long stalks, red to red-brown. The common name refers to the use of the species for making sugar and syrup.

        Variation within the species: Closely similar forms of sugar maple have been recognized at various taxonomic ranks – from varieties to subspecies and species. Three of them are now generally recognized as species, but the differences are technical and it is difficult to be sure of the correct identifications of trees sold as “sugar maple” in the southeastern US. Duncan and Duncan (1988) gives a good summary of the distribution and morphology of these species.

      • Florida maple (A. barbatum, including A. floridanum): primarily a species of the Gulf and southeast Atlantic coastal plain, from Texas to North Carolina and Virginia, and up the Mississippi valley as far as Missouri and Illinois.

    • chalk maple (A. leucoderme): similar in distribution to Florida maple, but not extending into Virginia or up the Mississippi valley.

  • black maple (A. nigrum): similar in distribution to ‘true’ sugar maple, but somewhat more restricted.

Norway maple (Acer platanoides), an introduced European species, is often planted and looks similar to sugar maple, but Norway maple has broader leaves with drooping lobes, and sap from a broken petiole is milky.

Distribution: Sugar maple is widespread in mixed hardwood forests of the eastern United States. It grows from Nova Scotia and New Brunswick westward to Ontario and Manitoba, North Dakota and South Dakota, southward into eastern Kansas into Oklahoma, and southward in the east through New England to Georgia. For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurrence in North America

     AL  AR  CT  DE  FL  GA  IA  IL  KS KY   
     LA  ME  MA  MI  MN  MO  NH  NJ NY  NC 
     OH  OK  PA  RI  SC  SD  TN  VT VA  WV 
     WI  MB  NB  NS  ON  QC

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sugar maple grows from Nova Scotia and New Brunswick westward to Ontario
and Manitoba, southward through Minnesota, and eastern Kansas into
northeastern Texas [46].  It extends eastward to Georgia and northward
through the Appalachian Mountains into New England [46,68].  Local
populations occur in northwestern South Carolina, northern Georgia, and
northeastern South Dakota [46].  Disjunct populations are known from the
Wichita Mountains of southwestern Oklahoma [16].
  • 68. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]
  • 16. Dooley, Karen. 1983. Description and dynamics of some western oak forests in Oklahoma. Norman, OK: University of Oklahoma. 62 p. Dissertation. [12145]
  • 46. Little, Elbert L., Jr. 1979. Checklist of United States trees (native and naturalized). Agric. Handb. 541. Washington, DC: U.S. Department of Agriculture, Forest Service. 375 p. [2952]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The native Sugar Maple is a common tree that occurs throughout Illinois (see Distribution Map); it probably occurs in every county. Habitats include rich mesic woodlands, sandy woodlands, wooded bluffs and hills, north-facing wooded slopes, wooded areas in protected coves and river valleys, lower slopes or bottoms of rocky ravines and canyons, and edges of limestone glades. Sugar Maple is often cultivated as a landscape tree in parks and yards. This tree is often the dominant canopy tree in mesic woodlands, or it can be codominant with American Beech or American Basswood. As a result of the suppression of wildfires and higher amounts of rainfall during the past several decades, it has displaced oaks, hickories, and other native trees in many woodlands around the state.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The northern limit of sugar maple nearly parallels the 35th mean  annual isotherm extending eastward from the extreme southeast  corner of Manitoba, through central Ontario, the southern third  of Quebec and all of New Brunswick and Nova Scotia. Within the  United States the species is found throughout New England, New  York, Pennsylvania, and the middle Atlantic States, extending  southwestward through central New Jersey to the Appalachian  Mountains, then southward through the western edge of North  Carolina to the southern border of Tennessee. The western limit  extends through Missouri into a small area of Kansas, the eastern  one-third of Iowa, and the eastern two-thirds of Minnesota. A few  outlier communities are found in northern Kansas, Georgia, and  the Carolinas.

   
  - The native range of sugar maple.


  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Ranges across North America from Maine and eastern Canada to Minnesota and the eastern Dakotas, southward to Mississippi, eastern Texas, and central Oklahoma.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adaptation

Sugar maple most commonly occurs in rich, mesic woods but also grows in drier upland woods. It often grows in canyons, ravines, valleys, stream terraces, and streambanks, but it is occasionally found on dry rocky hillsides, at 500-1700 meters elevation. It is a dominant or codominant in many northern hardwood and mixed mesophytic forests. Common codominants include beech (Fagus grandifolia), birch (Betula spp.), American basswood (Tilia americana), northern red oak (Quercus rubra), white oak (Quercus alba), and yellow poplar (Liriodendron tulifera), but it also grows with various other hardwood species as well as conifers such as pine, spruce, fir, and eastern hemlock.

In the absence of disturbance, forests of jack pine, eastern white pine, eastern hemlock, yellow birch, or red pine are replaced by sugar maple and American basswood. Because repeated disturbance by fire was common in eastern deciduous forests in pre-settlement times, succession to sugar maple-American basswood stands may have taken as long as 650 years in some locations. Increases in sugar maple during the past 50 years in central and Great Lakes hardwood forests have been attributed to fire suppression.

This species flowers in April-June, with fruiting occurring in June-October. Fruits ripen about 12-16 weeks after flowering and begin to fall about 2 weeks after ripening. Leaves generally drop just after seeds have fallen. At the southern edge of the species' range, dead leaves tend to remain on the trees through much of the winter.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Acer saccharum Marshall:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 1.0 of 5

Physical Description

Morphology

Description

More info for the terms: dioecious, monoecious, tree

Sugar maple is a deciduous tree which reaches 90 to 120 feet (27-37 m)
in height and 30 to 36 inches (76-91 cm) in d.b.h. [30,60].  Extremely
large specimens have reached more than 130 feet (40 m) in height and
more than 5 feet (1.5 m) in d.b.h. [36].  Sugar maple is long-lived and
plants can survive for 300 to 400 years [30].  The bark is light gray to
gray-brown and becomes deeply furrowed and rough with age [17].  Twigs
are a shiny, reddish-brown [36].  Sugar maple is relatively deep-rooted,
with many extensively-branched laterals [30,36].

Sugar maple is monoecious or dioecious [68].  Small, greenish-yellow
flowers are borne in tassellike clusters or racemes [9,36,68].  Each
drooping cluster contains 8 to 14 flowers [9,68].  Fruit is a paired,
papery-winged samara which averages 1 inch (2.5 cm) in length [30,32].
  • 68. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]
  • 9. Chapman, William K.; Bessette, Alan E. 1990. Trees and shrubs of the Adirondacks. Utica, NY: North Country Books, Inc. 131 p. [12766]
  • 17. Duncan, Wilbur H.; Duncan, Marion B. 1987. The Smithsonian guide to seaside plants of the Gulf and Atlantic Coasts from Louisiana to Massachusetts, exclusive of lower peninsular Florida. Washington, DC: Smithsonian Institution Press. 409 p. [12906]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 32. Great Plains Flora Association. 1986. Flora of the Great Plains. Lawrence, KS: University Press of Kansas. 1392 p. [1603]
  • 36. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 60. Radford, Albert E.; Ahles, Harry E.; Bell, C. Ritchie. 1968. Manual of the vascular flora of the Carolinas. Chapel Hill, NC: The University of North Carolina Press. 1183 p. [7606]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat characteristics

More info for the terms: cover, hardwood, marsh, mesic, natural, shrub, tree

Sugar maple most commonly occurs in rich, mesic woods but also grows in
drier upland woods [18,68].  It grows in level areas or in coves and
other sheltered locations on adjacent lower slopes [1,18,24].  Sugar
maple is often associated with stream terraces, streambanks, valleys,
canyons, ravines, and wooded natural levees [1,10,28,68].  It is
occasionally found on dry rocky hillsides [32].  At the western edge of
its range, sugar maple grows as scattered canopy seed trees or as
abundant seedlings in protected ravines and relatively mesic
north-facing slopes [77].

Sugar maple is a major species in seven SAF cover types and is common in
17 others [30].  It is a prominent component of mesic hardwood forests,
Great Lakes pine forests, spruce-fir forests, and northern hardwood
forests [12,22,67].  Sugar maple forms pure stands but also grows mixed
with other hardwoods and scattered conifers [36].  Common associates
include American basswood, yellow birch (Betula alleghaniensis), black
cherry (Prunus serotina), red spruce (Picea rubens), white spruce (P.
glauca), beech, eastern white pine (Pinus strobus), eastern hemlock
(Tsuga canadensis), northern red oak (Quercus rubra), white oak (Q.
alba), and yellow-poplar (Liriodendron tulipifera) [30].

Understory associates:  Understory associates of sugar maple are both
varied and numerous.  Common shrub associates include beaked hazel
(Corylus cornuta), Atlantic leatherwood (Dirca palustris), redberry
elder (Sambucus pubens), alternate-leaf dogwood (Cornus alternifolia),
dwarf bush-honeysuckle (Diervilla lonicera), Canada yew (Taxus
canadensis), red raspberry (Rubus idaeus), and blackberries (Rubus
spp.).  Springbeauty (Claytonia caroliniana), large-flowered trillium
(Trillium grandiflorum), anemone (Anemone spp.) marsh blue violet (Viola
cucullata), downy yellow violet (V. pubescens), Solomon's-seal
(Polygonatum pubescens), false Solomon's-seal (Smilacina stellata), sweet
cicely (Osmorhiza spp.), adderstongue (Ophioglossom vulgatum),
jack-in-the-pulpit (Arisaema atrorubens), clubmosses (Lycopodium spp.),
and largeleaf aster (Aster macrophyllus) [30].

Soils:  Sugar maple can grow on a wide variety of soils [30,75], but
typically grows best on deep, moist, fertile, well-drained soils [4,36].
It grows on sand, loamy sand, sandy loam, silty loam, and loam [30].
Sugar maple is commonly associated with alluvial or calcareous soils
[24,32] but also grows on stabilized dunes [75].  This tree is
intolerant of flooded soils [3] and generally grows poorly on dry,
shallow soils [30].  In parts of New England, sugar maple commonly grows
on soils rich in organics [30].  Sugar maple occurs on strongly acidic
(pH=3.7) to slightly alkaline (pH=7.3) soils but grows best where soil
pH ranges from 5.5 to 7.3.  Soils are derived from a variety of parent
materials including shale, limestone, and sandstone [68,62].

Elevation:  In the southern and southwestern portions of its range,
sugar maple generally grows at intermediate elevations [30].
Generalized elevational ranges by geographic location are as follows
[30]:

Location                Elevation

s Appalachian Mtns.     3,000 to 5,500 feet (910-1,680 m)
Lake States             up to 1,600 feet (490 m)
n New England           up to 2,500 feet (760 m)
New York                up to 2,500 feet (760 m)
  • 68. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]
  • 1. Adams, Dwight E.; Anderson, Roger C. 1980. Species response to a moisture gradient in central Illinois forests. American Journal of Botany. 67(3): 381-392. [13295]
  • 3. Arthur, J. J.; Leone, I. A.; Flower, F. B. 1981. Flooding and landfill gas effects on red and sugar maples. Journal of Environmental Quality. 10(4): 431-433. [12555]
  • 4. Auclair, Allan N.; Cottam, Grant. 1971. Dynamics of black cherry (Prunus serotina Erhr.) in southern Wisconsin oak forests. Ecological Monographs. 41(2): 153-177. [8102]
  • 10. Clewell, Andre F. 1985. Guide to the vascular plants of the Florida Panhandle. Tallahassee, FL: Florida State University Press. 605 p. [13124]
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 18. Duncan, Wilbur H.; Duncan, Marion B. 1988. Trees of the southeastern United States. Athens, GA: The University of Georgia Press. 322 p. [12764]
  • 22. Fahey, Timothy J.; Reiners, William A. 1981. Fire in the forests of Maine and New Hampshire. Bulletin of the Torrey Botanical Club. 108: 362-373. [9707]
  • 24. Fralish, James S. 1976. Forest site-community relationships in the Shawnee Hills region, southern Illinois. In: Fralish, James S.; Weaver, George T.; Schlesinger, Richard C., eds. Central hardwood forest conference: Proceedings of a meeting; 1976 October 17-19; Carbondale, IL. Carbondale, IL: Southern Illinois University: 65-87. [3813]
  • 28. Godfrey, Robert K. 1988. Trees, shrubs, and woody vines of northern Florida and adjacent Georgia and Alabama. Athens, GA: The University of Georgia Press. 734 p. [10239]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 32. Great Plains Flora Association. 1986. Flora of the Great Plains. Lawrence, KS: University Press of Kansas. 1392 p. [1603]
  • 36. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 62. Rice, Elroy L. 1962. The microclimate of sugar maple stands in Oklahoma. Ecology. 43: 19-25. [12751]
  • 67. Shugart, H. H., Jr.; Crow, T. R.; Hett, J. M. 1973. Forest succession models: a rationale and methodology for modeling forest succession over large regions. Forest Science. 19(3): 203-212. [7899]
  • 75. Voss, Edward G. 1985. Michigan flora. Part II. Dicots (Saururaceae--Cornaceae). Bull. 59. Bloomfield Hills, MI: Cranbrook Institute of Science; Ann Arbor, MI: University of Michigan Herbarium. 724 p. [11472]
  • 77. White, Peter S. 1979. Pattern, process, and natural disturbance in vegetation. Botanical Review. 45(3): 229-299. [7869]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Key Plant Community Associations

More info for the terms: association, codominant

Sugar maple grows in a wide variety of plant communities throughout
eastern North America.  It is a dominant or codominant in many northern
hardwood and mixed mesophytic communities.  Common codominants include
beech (Fagus grandifolia), birch (Betula spp.), and American basswood
(Tilia americana).  Sugar maple has been listed as a dominant or
indicator in the following community type (cts), ecosystem associations
(eas), dominance types (dts), and plant association (pas)
classifications:

Area                    Classification                Authority

s IL                    forest cts                    Fralish 1976
e IA                    forest dts                    Cahayla-Wynne & Glenn-
                                                      Lewin 1978
MI                      forest eas                    Pregitzer & Ramm 1984
MN                      forest cts                    Daubenmire 1936
s NY                    forest pas                    Wilm 1936  

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

     1  Jack pine
     5  Balsam fir
    16  Aspen
    17  Pin cherry
    19  Gray birch - red maple
    20  White pine - northern red oak - red maple
    21  Eastern white pine
    22  White pine - hemlock
    23  Eastern hemlock
    24  Hemlock - yellow birch
    25  Sugar maple - beech - yellow birch
    26  Sugar maple - basswood
    27  Basswood
    28  Black cherry - maple
    30  Red spruce - yellow birch
    31  Red spruce - sugar maple - beech
    32  Red spruce
    33  Red spruce - balsam fir
    34  Red spruce - Fraser fir
    35  Paper birch - red spruce - balsam fir
    40  Post oak - blackjack oak
    44  Chestnut oak
    51  White pine - chestnut oak
    52  White oak - black oak - northern red oak
    53  White oak
    55  Northern red oak
    57  Yellow-poplar
    58  Yellow-poplar - eastern hemlock
    59  Yellow-poplar - white oak - northern red oak
    60  Beech - sugar maple
    61  River birch - sycamore
    64  Sassafras - persimmon
   107  White spruce
   108  Red maple
   110  Black oak

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K093  Great Lakes spruce - fir forest
   K095  Great Lakes pine forest
   K096  Northeastern spruce - fir forest
   K097  Southeastern spruce - fir forest
   K098  Northern floodplain forest
   K099  Maple - basswood forest
   K100  Oak - hickory forest
   K102  Beech - maple forest
   K103  Mixed mesophytic forest
   K104  Appalachian oak forest
   K106  Northern hardwoods
   K107  Northern hardwoods - fir forest
   K108  Northern hardwoods - spruce forest
   K109  Transition between K104 and K106
   K110  Northeastern oak - pine forest
   K111  Oak - hickory - pine forest
   K112  Southern mixed forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

   FRES10  White - red - jack pine
   FRES11  Spruce - fir
   FRES13  Loblolly - shortleaf pine
   FRES15  Oak - hickory
   FRES16  Oak - gum - cypress
   FRES17  Elm - ash - cottonwood
   FRES18  Maple - beech - birch
   FRES19  Aspen - birch

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

The native Sugar Maple is a common tree that occurs throughout Illinois (see Distribution Map); it probably occurs in every county. Habitats include rich mesic woodlands, sandy woodlands, wooded bluffs and hills, north-facing wooded slopes, wooded areas in protected coves and river valleys, lower slopes or bottoms of rocky ravines and canyons, and edges of limestone glades. Sugar Maple is often cultivated as a landscape tree in parks and yards. This tree is often the dominant canopy tree in mesic woodlands, or it can be codominant with American Beech or American Basswood. As a result of the suppression of wildfires and higher amounts of rainfall during the past several decades, it has displaced oaks, hickories, and other native trees in many woodlands around the state.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Soils and Topography

Sugar maple grows on a wide variety of sites ranging from a site  index of about 12 m (40 ft) to nearly 24 m (80 ft) at age 50 (12,17,21,25,46,91).  Typical good quality second-growth stands usually fall  between site index 17 and 20 m (55 and 65 ft) for sugar maple at  base age 50 years. Height growth is slower after age 50 in the  eastern regions. Except on the best sites, the depth of the soil  and type of parent material has a marked influence on site index  (69).

    Sugar maple grows on sands, loamy sands, sandy loams, loams, and  silt loams but it does best on well-drained loams (30). It  does not grow well on dry, shallow soils and is rarely, if ever,  found in swamps (30). Sugar maple is soil-site specific  in southerly regions but abundant on a wide variety of soils in  the northern Lake States. It is mostly found on Spodosols,  Alfisols, and Mollisols among the soil orders. In New Hampshire,  sugar maple is associated with sites that have abundant organic  matter (69), and in West Virginia it is most abundant on areas  with high oak site indices (107).

    Sugar maple grows on soils ranging from strongly acid (pH 3.7) to  slightly alkaline (pH 7.3), but it most commonly grows on soils  with a pH of from 5.5 to 7.3 (30). The heavy leaf litter  typical of sugar maple tends to modify the pH and nutrient status  of the soil. The leaves contain about 1.81 percent calcium, 0.24  percent magnesium, 0.75 percent potassium, 0.11 percent  phosphorus, 0.67 percent nitrogen, and 11.85 percent ash, based  on dry weight. The pH of

    leaves ranges from 4.0 to 4.9. The calcium content remains  relatively uniform in trees growing with a pH range of 4.5 to 7.0  but drops as the soils become more acid (5). In the Lake States,  sugar maple is found at elevations up to 490 m (1,600 ft)-most  commonly on ridges between poorly drained areas and on soil with  at least 1 to 1.5 m (3 to 5 ft) to the water table. In northern  New England and New York State it grows at elevations up to 760 m  (2,500 ft). In the Green Mountains of Vermont and the White  Mountains of New Hampshire, especially, the upper limit lies in a  sharp horizontal band with a narrow transitional zone into the  Boreal forest types. In the southern Appalachians the upper  elevation ranges from 910 m (3,000 ft) to 1680 m (5,500 ft), with  the lower levels generally restricted to the cooler north slopes.  In the southern and southwestern parts of its range, sugar maple  more typically grows on moist flats and along ravines at  intermediate elevations in the rolling topography.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Climate

Sugar maple is restricted to regions with cool, moist climates. In  northern areas, January temperatures average about -18° C (0°  F) and July temperatures about 16° C (60° F). In the  southern portions of the range, January temperatures average  about 10° C (50° F) and July temperatures approach 27°  C
  (80°F), although moisture and aspect influence these  extremes. In the sugar maple region, typical ranges in  temperatures are from -40° C (-40° F) in the north to  38° C (100° F) in the southwestern areas. Occasional  extremes may be more than 11 C (20° F) lower or higher than  these.

    Precipitation averages range from about 510 mm (20 in) annually  near the western edge of the range to 2030 mm (80 in) in the  southern Appalachians. Much of the northeastern region receives  about 1270 mm (50 in) per year where substantial commercial  volumes of sugar maple are located. In general, the growing  season precipitation is well distributed and averages 380 mm (15  in) in the western areas and 1020 mm (40 in) in the East.  Snowfall often exceeds 2540 mm (100 in) in the northern portion  of the range.

    In the broad geographic area covered by sugar maple, the growing  season ranges from 80 to 260 days. The last killing frost usually  occurs from March 20 to June 15 and the first killing frost  occurs between September 1 and November 10. In mountainous areas  of the Northeast, climatic factors largely determine the upper  elevation limits of the species(97).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

Minimum seed-bearing age for sugar maple is 30-40 years; maximum seed production is reached after about 60 years of age. Seed is abundantly produced each year but peaks occur mostly from 2-5 years. Seeds are dispersed in fall and germinate in spring. Germination occurs on moist mineral soil or in the litter layer, at an optimal temperature of about 1 C. Seeds can remain viable for up to 5 years but few persist in the seed bank for more than one year. Sugar maple seeds require moist stratification at temperatures slightly above freezing for 35-90 days.

Sugar maple is shade-tolerant but seedlings in dense young stands may survive for only 5 years; those in older stands commonly persist for many years. Such a bank of abundant seedlings and saplings can remain suppressed until gaps are created by windfall or other disturbances, where they typically respond vigorously and rapidly to release. Sugar maples can live for up to 500 years.

Stump sprouting and root sprouting are moderately common means of vegetative reproduction after mechanical disturbance in natural conditions, especially in the northern part of its range, and layering occasionally occurs.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

While honeybees and other bees sometimes collect pollen from the male flowers of Sugar Maple, cross-pollination is not achieved because they fail to visit the female flowers, which offer neither nectar nor pollen as a floral reward. The foliage, plant juices, and wood of Sugar Maple and other maples (Acer spp.) are sources of food to many insects. Chief among these feeders are the caterpillars of Dryocampa rubicunda (Rosy Maple Moth), Heterocampa biundata (Maple Prominent), and many other moths (see Moth Table). Another group of insect feeders include the larvae of Glycobius speciosus (Sugar Maple Borer), Xylotrechus aceris (Gall-Making Maple Borer), and other wood-boring beetles (see Wood-Boring Beetle Table). Many leafhoppers (mainly Eratoneura spp.) and aphids (Drepanaphis spp. & others) suck plant juices of maples; some of these species prefer Sugar Maple as a host plant (see Leafhopper & Aphid Table). Other insect feeders include plant bugs (Coccobaphes frontifer, Lygocoris hirticulus, Lygocoris vitticollis, & Plagiognathus flavipes), Neopulvinaria innumerabilis (Cottony Maple Scale), Phenacoccus acericola (Maple Mealybug), larvae of the sawfly Caulocampus acericaulis (Maple Petiole Borer), the larvae of Dasineura communis (Maple Gouty Vein Midge), and the wood-boring larvae of some horntails (Xiphydria abdominalis & Xiphydria maculata). After the protective bark has been damaged during the spring, some insects feed on the copious sap flow of Sugar Maple. These sap feeders include honeybees, some adult butterflies (Mourning Cloak, Comma, & Red Admiral), and many kinds of adult flies
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sap-Visiting Insects of Sugar Maple in Illinois

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Forest Cover

In eastern North America sugar maple is a major component in 7  Society of American Foresters forest cover types, a common  associate in 17, and an infrequent species in 10 (20).

    Sugar maple is a major component in the following types:

    27 Sugar Maple
  26 Sugar Maple-Basswood
  25 Sugar Maple-Beech-Yellow Birch
  60 Beech-Sugar Maple
  28 Black Cherry-Maple
  31 Red Spruce-Sugar Maple-Beech
  16 Aspen (Canadian subtype)

    Sugar maple is a common associate in the following types:

    17 Pin Cherry
  107White Spruce
  32 Red Spruce
  30 Red Spruce-Yellow Birch
  35 Paper Birch-Red Spruce-Balsam Fir
  21 Eastern White Pine
  22 White Pine-Hemlock
  23 Eastern Hemlock
  20 White Pine-Northern Red Oak-Red Maple
  24 Hemlock-Yellow Birch
  108Red Maple
  19 Gray Birch-Red Maple
  55 Northern Red Oak
  57 Yellow-Poplar
  58 Yellow-Poplar-Eastern Hemlock
  59 Yellow-Poplar-white Oak-Northern Red Oak
  64 Sassafras-Persimmon

    It occurs as an infrequent species in Jack Pine(Type 1), Balsam  Fir (Type 5), Aspen (Type 16), Red Spruce-Balsam Fir (Type 33),  Red Spruce-Fraser Fir(Type 34), Chestnut Oak (Type 44), Pitch  Pine (Type 45), White Pine-Chestnut Oak (Type 51), White  Oak-Black Oak-Northern Red Oak (Type 52), and River  Birch-Sycamore (Type 61).

    Large numbers of shrubs are found with sugar maple because of its  varied altitudinal distribution. The most common within the  commercial range are beaked hazel (Corylus cornuta), Atlantic  leatherwood (Dirca palustris), redberry elder (Sambucus  pubens), American elder (S. canadensis), alternate-leaf  dogwood (Corn us alternifolia), dwarf bush-honeysuckle  (Diervilla lonicera), Canada yew (Taxus canadensis),  red raspberry (Rubus idaeus), and blackberries (Rubus  spp.). Common flowering plants include springbeauty (Claytonia  caroliniana), large-flowered trillium (Thulium  grandiflorum), anemone (Anemone spp.), marsh blue  violet (Viola cucullata), downy yellow violet (V.  pubescens), Solomons-seal (Polygonatum pubescens), false  Solomons-seal (Smilacina stellata), sweet cicely (Osmorhiza  spp.), adderstongue (Ophioglossom vulgatum), jack-in-the-pulpit  (Arisaema atrorubens), clubmosses (Lycopodium spp.),  and largeleaf aster (Aster macrophyllus).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Damaging Agents

Early studies in old-growth sugar maple  indicated that after two or possibly three cyclic cuts  had been made, few damaging agents would affect trees or stands.  Current work in second-growth, however, shows some major agents,  particularly in even-aged stands (77,122).

    At least two species of bud miners, Proteoteras moffatiana  and Obrussa ochrefasciella, overwinter in the  terminal bud of sugar maple and kill it. This causes repeated  forking, which reduces merchantable log length and adds to the  risk of crown loss from splitting. Other bud-damaging insects  that may also cause forks are Choristoneura rosaceanaCenopis pettitana, Phyllobius oblongus, and Platycerus  virescens (65,66,7798,123).

    Forking at the terminal bud occurs in trees of all ages but is  especially pronounced in overstory trees. Side crowding and  overhead shading help correct lower forking (32). But  early or heavy thinning sets the fork and causes shorter  merchantable lengths. As fork members increase in size and  weight, fork breakage also increases.

    Except for bud losses, sugar maple is not highly susceptible to  insect injury and serious outbreaks are not common (62). The  most common insects to attack sugar maple are defoliators and  these include the gypsy moth (Lymantria dispar), forest  tent caterpillar (Malacosoma disstria), linden looper  (Erannis tiliaria), fall cankerworm (Alsophila  pometaria), spring cankerworm (Paleacrita vernata), green-striped  mapleworm (Anisota rubicunda), Bruce span-worm (Operophtera  bruceata), maple leaf-cutter (Paraclemensia  acerifoliella), maple trumpet skeletonizer (Epinotia  aceriella), and saddled prominent (Heterocampa  guttivitta).

    One insect of the genus Phytobia occasionally causes pith  flecks that seriously degrade veneer logs. This insect tunnels  the full length of the cambium layer and exits near the root  collar (117).

    Borers that attack sugar maple include the carpenterworm (Prionoxystus  robiniae), sugar maple borer (Glycobius speciosus), maple  callus borer (Synanthedon acerni), and occasionally  horntajls (Xiphydria abdominalis and X. maculata)  (95).


    Sucking insects that affect sugar maple include the woolly alder  aphid (Prociphilus tesselatus) and other aphid species  (Neoprociphilus aceris and Periphyllus lyropictuswhich injure leaves and reduce growth.

    Of the scale insects, the maple phenacoccus (Phenacoccus  acericola), is the most important to sugar maple. The maple  leaf scale (Pulvinaria acericola) and the gloomy scale  (Melanaspis tenebricosa) also frequently attack sugar  maple.

    Many sugar maple trees died in a small area of Wisconsin and  Michigan in 1957 (113). Certain insects-the leaf rollers  (Sparganothis acerivorana and Acleris chalybeanaand the maple webworm (Tetralopha asperatel1a)combined  with disease and climatic factors were thought to be the  cause of this mortality (44,48,61,120). The decline has  abated but appears to have recurred with less severity on a  portion of the same area in the late 1970's.

    Diseases of sugar maple generally deform, discolor, or decrease  volume but seldom kill the tree (80). The two most  important diseases in managed second-growth are probably  Eutypella (Eutypella parasitica) and Nectria (Nectria  galligena) cankers. In the Lake States these cankers each  affect from about 1 to 4 percent of the trees (77) but in  Ontario they occur more frequently (60,87). Nectria  canker is more prevalent following shelterwood cuttings, probably  because conditions favorable for infection are established (2).  Two other cankers (Schizoxylon micro sporum and Hypoxylon  lilakei) occur rarely on sugar maple. In a few instances  cankers may kill a tree but generally only predispose it to  breakage.

    Some common fungi-causing heart rots in sugar maple are Armillaria  mellea, primarily a root-rotting fungus; Hydnum  septentrionale, which causes a soft, spongy, white heart rot;  Inonotus glomeratus, which causes white to light brown  spongy heart rot; and Ustulina vulgaris, which causes a  butt rot (30).

    The amount of defect in sugar maple trees in virgin and unmanaged  stands is usually high-commonly from 35 to 50 percent (30).  Defect resulting from logging damage usually is minor in  small wounds for as long as 10 years, but 20-cm (8-in) scars all  were infected within 20 years and value losses were significant  (47,81).

    Logging injuries to the stems of residual trees and to  reproduction frequently result in the entrance of decay and  eventually serious volume loss (6,79). In a study in  Upper Michigan at least 30 percent of the logging scars on the  main stem of older trees resulted in serious defects within 15 to  20 years (30). Larger limbs broken in logging also  usually result in serious defects (93,94). In Upper  Michigan after a 20-year period about 8 percent cull resulted  from decay and stain that had entered through scars on limbs 10  cm (4 in) and larger (30). Smaller limb breakage exposing  only sapwood, however, generally results in little volume loss  (4,30).

    Two wilts occasionally attack and kill sugar maple. Sapstreak,  caused by Ceratocystis coerulenscens, enters through root  injuries from logging and has been reported in several localities  (56,57,80). Verticillium wilt, caused by Verticillium  albo-atrum, is usually found only in shade trees. This wilt  also invades the trees through the roots.

    When stored for more than a year, a saprophytic fungus, Cryptostroma  corticale, sometimes develops on the bark of sugar maple. The  spores from this fungus are released during processing and have  caused bronchial asthma and severe allergenic lung disorders to  millworkers (83,84).

    Physical and climatic injuries often occur on sugar maple. Much  damage from glaze storms occurred in New York in 1942. The  injured trees showed a slight tendency to sprout and renew  growth. Many of the smaller trees that had 85 percent or more of  their crown broken away developed saprot (30).

    Winter sunscald frequently occurs in even-aged sugar maple stands.  Trees are damaged from late winter heating of the bole above the  snowline on bright sunny days followed by rapid freezing that  ruptures the cells. Most injury occurs when the stems are 2.5 to  7.6 cm (1 to 3 in) in d.b.h., and certain topographic positions  are affected more than others (55). Healing in dense stands is  slow, if at all, and later stages often appear to be a simple  frost crack. Various fungi may be present but may or may not  prevent closure (59). Part of the lack of closure may be  due to shrinkage and swelling of the bole associated with changes  in air temperature (35).

    In some areas the lower portion of sugar maple boles contains many  vertical cracks from 2.5 to 7.6 cm (1 to 3 in) long. Although  these cracks have been termed annual maple cankers, the causal  agent does not seem to be a fungus. These cankers slowly  disappear and new ones recur at short intervals (32). In  Pennsylvania they were most common on slowly permeable soils (116)  but no specific cause has been identified (3,58).

    Sugar maple can be severely damaged from deicing road salt (96).  In an industrial area the number of overstory sugar maples  was markedly reduced from exposure to sulfur oxides, nitrogen  oxides, chlorides, and fluorides. Sugar maple remained an  abundant species in the understory because of a lower exposure  level (72).

    Numerous animals feed on or injure sugar maple without serious  effect except in local and limited situations. Deer browsing is  probably the most common wildlife factor. Winter browsing in the  Lake States causes little damage or reduced growth (51,100).  In the central Adirondacks, however, continual browsing of  sugar maple allows American beech, which the deer avoid, to  dominate northern hardwood understories (54).

    Red, grey, and flying squirrels sometimes gnaw or feed on the  seed, buds, foliage, and twigs of sugar maple. In rare instances,  they have girdled and killed larger branches and tree tops (30,100).  Porcupines may feed on the bark and kill the top by girdling  the upper stem (8,30).

    Sapsuckers frequently peck and cause degrade in some sugar maple  trees but rarely, if ever, kill the tree (19,82,90,92). On  heavily pecked trees in the spring a fungus develops on the sap  and causes the bark to turn black (82). Such trees  probably should be retained in the stand to prevent other trees  from being attacked.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Widespread and abundant in the eastern and midwestern United States, into southern Canada. While essentially continuous in large areas (at least before fragmentation due to agriculture and development), the main range can be considered to include many hundreds of reasonably independent, self-maintaining stands. Nevertheless, genetic mixing by storm-blown pollen and seeds lead to metapopulation dynamics within aggregations of such areas. There are also a number of outlying stands that can be considered occurrences as well.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Considerations

Fuels/flammability:  The average ash content of dead sugar maple leaves
collected in two Michigan counties was documented as follows [47]:

               Wexford Co.       Ingham Co.
                         (percent)
Fall              7.1              8.5        
Spring            9.2             12.2
Early summer     10.3             13.1
  • 47. Loomis, Robert M. 1982. Seasonal variations in ash content of some Michigan forest floor fuels. Res. Note NC-279. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 3 p. [13243]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Plant Response to Fire

More info for the term: prescribed fire

The Research Project Summaries Effects of surface fires in a mixed red and
eastern white pine stand in Michigan
and Early postfire effects of a prescribed
fire in the southern Appalachians of North Carolina
, and the Research Paper by Bowles and others 2007 provide information on prescribed fire and postfire response
of several plant species, including sugar maple, that was not available when this
species review was originally written.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

Sugar maple sprouts poorly after fire [40].  Mature trees that have been
top-killed by fire do not sprout, small saplings occasionally sucker
[12].  Although sprouting is common in young sugar maples following
mechanical disturbances, it is relatively uncommon after fire.  Sugar
maple reestablishes through seedling sprouts and seedlings [49].
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 40. Kittredge, J., Jr. 1934. Evidence of the rate of forest succession on Star Island, Minnesota. Ecology. 15(1): 24-35. [10102]
  • 49. Maissurow, D. K. 1941. The role of fire in the perpetuation of virgin forests of northern Wisconsin. Journal of Forestry. 39(2): 201-207. [3445]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

More info for the terms: litter, mesic

Sugar maple is sensitive to fire [13].  The thin bark is easily damaged
by even light ground fires [12].  Curtis [12] reported that "cambial
injury occurs even in trees that show little external damage."  Large
trees occasionally survive light fires and may exhibit visible fire
scars [40].  Hot fires can kill existing regeneration [49].

Sugar maple commonly occurs in mesic closed canopy forests that are
relatively resistant to ground fires, particularly during the winter and
spring when litter is usually moist [12].  In the summer, flammable
litter (generally deciduous leaves) is often scarce or absent.  Greatest
fire hazard occurs in dry years during October, after the leaves have
fallen [12].  Fires which occur during this time period are occasionally
severe and can kill the entire stand.  In a Tennessee loblolly pine
stand, DeBruyn and Buckner [14] reported 85 percent mortality in sugar
maple following a fall burn when fuels were very dry.
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 13. Daubenmire, Rexford F. 1936. The "big woods" of Minnesota: its structure, and relation to climate, fire, and soils. Ecological Monographs. 6(2): 233-268. [2697]
  • 14. de Bruyn, Peter; Buckner, Edward. 1981. Prescribed fire on sloping terrain in west Tennessee to maintain loblolly pine (Pinus taeda). In: Barnett, James P., ed. Proceedings, 1st biennial southern silvicultural research conference; 1980 November 6-7; Atlanta, GA. Gen. Tech. Rep. SO-34. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 67-69. [12091]
  • 40. Kittredge, J., Jr. 1934. Evidence of the rate of forest succession on Star Island, Minnesota. Ecology. 15(1): 24-35. [10102]
  • 49. Maissurow, D. K. 1941. The role of fire in the perpetuation of virgin forests of northern Wisconsin. Journal of Forestry. 39(2): 201-207. [3445]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the term: root crown

   survivor species; on-site surviving root crown or caudex
   off-site colonizer; seed carried by wind; postfire yrs 1 and 2

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: fire suppression, hardwood

Sugar maple typically increases in the absence of fire [40].  Seedlings
occasionally sprout, but postfire establishment occurs primarily through
an abundance of wind-dispersed seed.

Central States:  Fire has played an important role in deciduous forests
of the central and eastern United States [63,76].  Fire suppression has
favored sugar maple and other northern hardwood species, while
fire-tolerant species such as white oak, northern red oak, and Shumard
oak (Quercus shumardii) have experienced declines [55].  Dramatic
increases in sugar maple during the past 48 years in central hardwood
forests have been attributed to fire suppression [65].  Sugar maple was
formerly nearly absent in areas of central Missouri which bordered the
fire-prone prairies [55].  Since settlement times, it has increased as
mean fire intervals have declined.

The Southeast:  Fire was a major influence in presettlement forests of
the Southeast [73].  Increased fire suppression in this region has also
favored shade-tolerant hardwoods, such as sugar maple, and has resulted
in a decrease in oaks [73].

Northeast:  Mean fire intervals are typically long in most northern
hardwood forests.  In New England, fire is a less important disturbance
agent than windthrow or insect infestations [22].  In northern hardwood
stands in Maine and New Hampshire, mean fire intervals in presettlement
forests ranged from 230 to 4,970 years [22].  In New Brunswick, fire
rotations have been estimated at 625 years in both sugar maple-yellow
birch-fir and sugar maple-eastern hemlock-pine forests [22].  In
hardwood stands in parts of New Hampshire, sugar maple has been
increasing [45].

Great Lakes Region:  Northern hardwood forests of the Great Lakes Region
lie between the fire-prone savanna and prairie communities to the south
and west [8].  Fires in these forests were presumably fairly common in
presettlement times but may have occurred at intervals which exceeded
the lifespan of individual trees [8].  Shade-tolerant species, such as
sugar maple, commonly assume dominance in the absence of fire in Great
Lake's hardwood forests.  Where fire frequencies are high, aspen and
paper birch (Betula papyrifera) are common dominants [69].  In
presettlement times, sugar maple was typically absent from portions of
the North Woods which burned at frequent intervals [13].
  • 8. Canham, Charles D.; Loucks, Orie L. 1984. Catastrophic windthrow in the presettlement forests of Wisconsin. Ecology. 65(3): 803-809. [13438]
  • 13. Daubenmire, Rexford F. 1936. The "big woods" of Minnesota: its structure, and relation to climate, fire, and soils. Ecological Monographs. 6(2): 233-268. [2697]
  • 22. Fahey, Timothy J.; Reiners, William A. 1981. Fire in the forests of Maine and New Hampshire. Bulletin of the Torrey Botanical Club. 108: 362-373. [9707]
  • 40. Kittredge, J., Jr. 1934. Evidence of the rate of forest succession on Star Island, Minnesota. Ecology. 15(1): 24-35. [10102]
  • 45. Leak, W. B. 1975. Age distribution in virgin red spruce and northern hardwoods. Ecology. 56: 1451-1454. [8690]
  • 55. Pallardy, S. G.; Nigh, T. A.; Garrett, H. E. 1988. Changes in forest composition in central Missouri: 1968-1982. The American Midland Naturalist. 120(2): 380-390. [9043]
  • 63. Rouse, Cary. 1986. Fire effects in northeastern forests: oak. Gen. Tech. Rep. NC-105. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 7 p. [3884]
  • 65. Schlesinger, Richard C. 1989. Dynamics of the sugar maple component of a white oak-yellow poplar community. In: Rink, George; Budelsky, Carl A., eds. Proceedings, 7th central hardwood conference; 1989 March 5-8; Carbondale, IL. Gen. Tech. Rep. NC-132. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 262-266. [9388]
  • 69. Swan, Frederick R., Jr. 1970. Post-fire response of four plant communities in south-central New York state. Ecology. 51(6): 1074-1082. [3446]
  • 73. Van Lear, David H.; Waldrop, Thomas A. 1989. History, uses, and effects of fire in the Appalachians. Gen. Tech. Rep. SE-54. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 20 p. [10126]
  • 76. Ward, Jeffrey S.; Stephens, George R. 1989. Long-term effects of a 1932 surface fire on stand structure in a Connecticut mixed hardwood forest. In: Rink, George; Budelsky, Carl A., eds. Proceedings, 7th central hardwood conference; 1989 March 5-8; Carbondale, IL. Gen. Tech. Rep. NC-132. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 267-273. [9389]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the term: climax

Sugar maple is very tolerant of shade and can persist for long periods
beneath a dense forest canopy [30].  It is noted for its ability to
quickly occupy gaps created in the forest canopy [37,64].  A bank of
abundant seedlings remains suppressed until gaps are created by windfall
or other disturbances [37].  Seedlings and saplings typically respond
vigorously and rapidly to release and can overtop competitors such as
northern red oak.  Openings or gaps in the canopy allow more nutrients,
light, and water to become available [37].  In many areas, sugar maple
is a dominant species in gaps created by dying American elms [56].

Sugar maple is generally regarded as a late seral or climax species in
many eastern deciduous forests [57].  However, as Parker and Sherwood
[58] note, the "long-term dynamics of eastern deciduous forests are not
well understood."  Throughout much of the Upper Midwest, sugar maple
codominates climax stands with American basswood, or yellow birch
[4,13,23].  In the absence of disturbance, forests composed of jack
pine, eastern white pine, eastern hemlock, yellow birch, or red pine are
replaced by sugar maple and American basswood [12,21,69].  However, it
should be noted that disturbances, particularly fire, were common in
eastern deciduous forests in presettlement times.  In some locations,
succession to sugar maple-American basswood stands may have taken as
long as 650 years [40].
  • 4. Auclair, Allan N.; Cottam, Grant. 1971. Dynamics of black cherry (Prunus serotina Erhr.) in southern Wisconsin oak forests. Ecological Monographs. 41(2): 153-177. [8102]
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 13. Daubenmire, Rexford F. 1936. The "big woods" of Minnesota: its structure, and relation to climate, fire, and soils. Ecological Monographs. 6(2): 233-268. [2697]
  • 21. Eyre, F. H.; LeBarron, Russell K. 1944. Management of jack pine stands in the Lake States. Tech. Bull. No. 863. Washington, DC: U.S. Department of Agriculture, Forest Service. 66 p. [11643]
  • 23. Fox, John F. 1977. Alternation and coexistence of tree species. The The American Naturalist. 111(977): 69-89. [212]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 37. Houle, Gilles. 1990. Growth patterns of sugar maple seedlings and mature trees in healthy and in declining hardwood stands. Canadian Journal of Forestry Research. 20: 849-901. [12112]
  • 40. Kittredge, J., Jr. 1934. Evidence of the rate of forest succession on Star Island, Minnesota. Ecology. 15(1): 24-35. [10102]
  • 56. Parker, George R.; Leopold, Donald J. 1983. Replacement of Ulmus americana L. in a mature east-central Indiana woods. Bulletin of the Torrey Botanical Club. 110(4): 482-488. [5641]
  • 57. Parker, G. R.; Leopold, D. J.; Eichenberger, J. K. 1985. Tree dynamics in an old-growth, deciduous forest. Forest Ecology and Management. 11(1&2): 31-57. [13314]
  • 58. Perala, Donald A.; Alm, Alvin A. 1989. Regenerating paper birch in the lake states with the shelterwood method. Northern Journal of Applied Forestry. 6: 151-153. [10900]
  • 64. Runkle, James R. 1990. Gap dynamics in an Ohio Acer-Fagus forest and speculations on the geography of disturbance. Canadian Journal of Forestry Research. 20: 632-641. [11786]
  • 69. Swan, Frederick R., Jr. 1970. Post-fire response of four plant communities in south-central New York state. Ecology. 51(6): 1074-1082. [3446]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: avoidance, layering

Sugar maple reproduces through seed and by vegetative means. 

Seed:  Sugar maple possesses extremely effective outbreeding mechanisms
[70], and flowers are readily wind pollinated [30].  Minimum
seed-bearing age is 30 to 40 years [30,54].  Forty- to sixty-year-old
trees with 8-inch (20 cm) d.b.h. produce light crops, whereas 70- to
100-year-old trees with d.b.h. of 10 to 14 inches (25-36 cm) produce
moderate seed crops [30].  Large fluctuations in annual seed crops have
been reported [70].  Seed production is partly dependent on genetic
factors, and some trees produce an abundance of flowers nearly every
year [42].  In north-central Wisconsin, good or better crops are
produced at 1- to 4-year intervals [30].  Elsewhere in the United
States, good crops occur at 2- to 5-year intervals, and in Canada, at 3-
to 7-year intervals [30].  In good crop years, 264 seeds per meter
square may be produced [38].

Seed dispersal:  Seed is primarily dispersed by wind [54], which can
carry the relatively large seeds for up to 330 feet (100 m) [30].
However, most seeds do not travel more than 49 feet (15 m) from the
forest edge [38].  Some sugar maple seed may also be dispersed by water
[54].

Seed banking:  Sugar maple seed can remain viable for up to 5 years when
properly stored [30].  However, few seeds persist in the seed bank for
more than 1 year [38], and sugar maple is not considered an important
seed banker [51].

Seedling establishment:  Seedling recruitment varies annually; periodic
high seedling densities may function as a predator avoidance mechanism
[70].  In favorable years seedling recruitment may reach 18.7 seedlings
per meter square, but in poor years no seedling recruitment occurs [38].
Seedlings can survive for long periods when suppressed beneath a forest
canopy and respond quickly to release.  Seedlings in very dense young
stands may survive for only 5 years, but in stands where trees average
10 inches (25 cm) or more in d.b.h., seedlings commonly persist for many
years.  Initial seedling growth is slow [30], and mortality is often
high [70].

Vegetative regeneration:  Sugar maple is a prolific sprouter in the
northern part of its range, but at the southern edge of its range, it
sprouts less vigorously than associated hardwoods [30].  Stump-sprouting
and root-sprouting are moderately common [38].  Layering occasionally
occurs [30].
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 38. Hughes, Jeffrey W.; Fahey, Timothy J. 1988. Seed dispersal and colonization in a disturbed northern hardwood forest. Bulletin of the Torrey Botanical Club. 115(2): 89-99. [10894]
  • 42. Kriebel, H. B.; Gabriel, W. J. 1969. Genetics of sugar maple. Res. Pap. WO-7. Washington, DC: U.S. Department of Agriculture, Forest Service.17 p. [12750]
  • 51. Mladenoff, David J. 1990. The relationship of the soil seed bank and understory vegetation in old-growth northern hardwood-hemlock treefall gaps. Canadian Journal of Botany. 68: 2714-2721. [13477]
  • 54. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 70. Brothers, Timothy S. 1985. Riparian species distributions in relation to stream dynamics, San Gabriel River, California. Los Angeles: University of California. 120 p. Dissertation. [8971]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the terms: chamaephyte, geophyte, hemicryptophyte, phanerophyte

   Undisturbed State:  Phanerophyte (mesophanerophyte)
   Undisturbed State:  Phanerophyte (megaphanerophyte)
   Burned or Clipped State:  Chamaephyte
   Burned or Clipped State:  Hemicryptophyte
   Burned or Clipped State:  Cryptophyte (geophyte)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: tree

Tree

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reaction to Competition

Sugar maple is rated as  very tolerant of shade, exceeded among hardwoods only by a few  smaller, shorter lived species. In large trees, only American  beech (Fagus grandifolia) equals it in tolerance under  forest conditions (30). Maximum photosynthetic activity  generally occurs under about 25 percent of full sunlight. The  species can survive for long periods under heavy shade and still  show a strong response to release (30).

    Release is seldom justifiable for young sugar maple stands  subjected to suppression from scattered dominant trees or pin  cherry (Prunus pensylvanica) because the sugar maple will  overcome suppression under those conditions (30). Release  is needed, however, when sugar maple competes with striped maple  (Acer pensylvanicum), black cherry (Prunus serotina),  yellow-poplar (Liriodendron tulipifera), and the oaks  (Quercus spp.), because growth is retarded and survival  is reduced by such competition (107).

    One sapling stand study showed that unreleased, dominant trees of  good vigor averaged 23 mm (0.9 in) in diameter growth and heavily  released trees averaged 46 mm (1.8 in) in diameter growth per  year during a 7-year period; unreleased, codominant trees of good  vigor averaged 18 mm (0.7 in) in diameter growth and heavily  released trees 38 mm (1.5 in). Pole-size trees also respond well  to release (31,102).

    If released too much, sugar maple readily develops epicormic  sprouts from dormant buds (14,31,33, 36,78). Gradual  release and good crown development provide adequate control over  epicormic sprouting and also enhance natural pruning of epicormic  branches on the lower bole. Consequently, proper thinning at  scheduled intervals is necessary to encourage quality improvement  as well as diameter growth.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rooting Habit

The root system of sugar maple has  strong, oblique laterals with extensive branching. Roots on the  upper side of the laterals grow upward into the humus layers and  those on the lower side grow downward. Most of the fine feeder  roots remain within the general area of origin (23,103).  Intraspecific root grafting is common.

    Although some root growth may continue throughout the year if the  soil does not freeze, the bulk of the new root regeneration  depends on growth factors exported from physiologically  nondormant buds. In northern races of sugar maple, about 2,500  hours of continuous chilling are required to break bud dormancy  (64).

    Sugar maple roots are extremely sensitive to flooding during the  growing season. The roots of maple form both endotrophic and  ectotrophic mycorrhizae.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sugar maple is widespread and dominant or codominant in many northern hardwood and mixed mesophytic forests of the eastern United States. It occurs in rich, mesic (moist) woods but also grows in drier upland woods. In 2002, it was one of the 10 most abundant tree species in the U.S. (FIA 2011). Sugar maple is declining in some northeastern forests (such as the Alleghenies), due to its sensitivity to acid rain and other pollution; it may be replaced by opportunistic species in frequently cut or highly disturbed forests (Wikipedia, 2011). In other regions, sugar maple has increased, possibly due to fire suppression (Potter-Witter and Lacksen 1993; MapleInfo.org 2011).

Animals that feed on sugar maple seeds, buds, twigs, and leaves include white-tailed deer, moose, snowshoe hare, red, gray, and flying squirrels, and numerous lepidopteran larvae and aphids. Porcupines consume the bark and can girdle the upper stem. Songbirds and woodpeckers, and cavity nesters nest in sugar maple. The flowers appear to be wind-pollinated, but the early-produced pollen is important for Apis mellifera (honeybees) and other insects.
  • FIA. 2011. Current U.S. forest data and maps. Forest Inventory and Analysis Program, U.S. Forest Service, U.S. Department of Agriculture. Retrieved September 12, 2011 from http://fia.fs.fed.us/.
  • MapleInfo.org. 2011. “Birdseye in sugar maple.” State of Vermont, Department of Forests, Parks, and Recreation. Retrieved on September 12, 2011, from http://www.mapleinfo.org/htm/bird.cfm.
  • Potter-Witter, K., and J. T. Lacksen. 1993. The Status of the Maple-Birch Forest Type in Michigan. Michigan State University, Department of Forestry Michigan State University. Research Report 533. May 1993. http://www.for.msu.edu/extension/ExtDocs/mplebrch.htm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Jacqueline Courteau

Supplier: Jacqueline Courteau

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

More info for the term: association

Growth initiation of sugar maple varies geographically [42].  Flower
buds generally begin to swell prior to the development of vegetative
buds and generally emerge 1 to 2 weeks before the leaves appear [30].
Male and female flowers mature at slightly different rates, which
promotes cross-pollination [42].  Fruit ripens approximately 12 to 16
weeks after the flowers appear [30,70].  Fruit begins to fall
approximately 2 weeks after ripening [30].  Flowering and fruiting dates
by geographic location are as follows:

Location          Flowering         Fruiting          Authority

Adirondack Mtns.  May               Sept.-Oct.        Chapman & Bessette 1990
Blue Ridge Mtns.  April-June        ----              Wofford 1989
FL Panhandle      March             ----              Clewell 1985     
Great Plains      April-May         ----              Great Plains Flora
                                                      Association 1986 
Gulf & Atlantic   April - May       ----              Duncan & Duncan 1987   
      Coasts                                               
New England       April 28-May 1-23 ----              Seymour 1985
NC, SC            April - May       June - Oct.       Radford & others 1968
se US             March - May       ----              Duncan & Duncan 1988

Leaves turn yellow to orange or deep red in the fall [6] and generally
drop just after seeds have fallen [30].  At the southern edge of the
species' range, dead brown leaves tend to remain on the trees through
much of the winter [28].  Trees from the northern portion of the
species' range become dormant earlier than do those from the South [42].
  • 6. Braun, E. Lucy. 1961. The woody plants of Ohio. Columbus, OH: Ohio State University Press. 362 p. [12914]
  • 28. Godfrey, Robert K. 1988. Trees, shrubs, and woody vines of northern Florida and adjacent Georgia and Alabama. Athens, GA: The University of Georgia Press. 734 p. [10239]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 42. Kriebel, H. B.; Gabriel, W. J. 1969. Genetics of sugar maple. Res. Pap. WO-7. Washington, DC: U.S. Department of Agriculture, Forest Service.17 p. [12750]
  • 70. Brothers, Timothy S. 1985. Riparian species distributions in relation to stream dynamics, San Gabriel River, California. Los Angeles: University of California. 120 p. Dissertation. [8971]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Vegetative Reproduction

Sugar maple reproduces by  stump sprouts and will occasionally layer (22). Root  suckering is rare. Seedlings broken during logging readily sprout  from dormant buds on the lower bole and quickly regain the height  of undamaged seedlings (52). Initial deformities,  primarily crook, and stem losses from deer browsing are rapidly  overgrown and corrected without development of internal rot (51).

    In older stands, the percentage of stumps sprouting decreases with  increase in tree size, stand density, and years since cutting.  Two years after a cutting in northern Michigan, the most  sprouting occurred on 15-cm (6-in) trees and the least sprouting  on 76-cm (30-in) trees. The percent of stumps sprouting averaged  94 and 38, respectively. Five years after cutting, the percent of  sprouting dropped to about 58 and 6, respectively. The number of  sprouts per stump also declined with years since cutting (30).  Sugar maple is a prolific sprouter in the North, but it  sprouts less than other hardwood species in the southern part of  its range (9,86,88,99).

    Cuttings of sugar maple can be rooted but may later fail due to  poor overwintering survival. Cuttings can be successfully  overwintered by forcing the cutting to break bud and produce a  flush of new growth immediately after it roots with the use of  gibberellic acid (128). Rooting response varies greatly  between clones-differences range from 0 to 100 percent, and  rooting response tends to be consistent from year to year. Timing  the collection of cuttings is critical; those taken in mid-June  generally give the best results. A rooting medium consisting of a  1 to 1 mixture of perlite and sphagnum moss, with intermittent  misting, has worked well with sugar maple cuttings. The  reliability of cuttings to propagate trees with figured wood,  such as curly grain and bird's-eye, has not been verified (30).

    Sugar maple trees with desirable genetic characteristics can be  reproduced by grafting. Success with this method can be highly  variable depending to a large degree on grafting techniques, that  is, when and under what conditions the scions were collected and  handled, treatment of the rootstock, and experience of the  grafters (129). Of the various methods available, bud  grafting is used most commonly and with a high degree of success  by commercial nurserymen (64).

    Air-layering, a method of propagation that stimulates root  development on branches still attached to the parent tree, is  another method that has been successfully used (16). A  major disadvantage of this procedure is that branches on some  trees selected for propagation may not be readily accessible.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seedling Development

Seedlings of sugar maple are  very shade tolerant and can survive long periods of suppression.  In a study of seedling height for 5 years after germination under  low lath shade in central Ontario, the tallest seedlings were  found under about 65 percent shade, averaging about 127 cm (50  in) tall (34,71). Heights were greater than 102 cm (40  in) from about 35 to 90 percent of full sunlight, with average  heights decreasing at more open and heavier shading. A  significant finding in this study was that supplemental watering  was necessary for survival at more than 55 percent of full  sunlight. Dry weight and root development were little affected by  the level of light. A Vermont study of shade levels showed no  significant difference in seedlings grown under 0, 30, and 60  percent shade but found a marked decrease in development under 90  percent shade. Seedlings grown under the different shade  treatments showed no difference, however, in either height or  diameter growth 4 years after field planting (125).

    Sugar maple roots release an exudate that can inhibit the growth  of yellow birch when the root growth periods coincide, thus  gaining a growth advantage over one of its associated species  (110). Other tree species may be similarly affected.  Aster and goldenrod exert an allelopathic effect on sugar maple  by reducing germination and early growth of seedlings (24).

    The growth of understory seedlings begins before the overstory  leafs out, generally about mid-May in Upper Michigan. About 90  percent of the seasonal height growth occurs within 18 days under  dense stands and 24 days in the open (50). The major  growth of other species studied extended about three times  longer.

    Seedling numbers greater than 370,500/ha (150,000/acre) are  common, although as many as 50 percent of the new seedlings may  not survive the first year. Seedlings in the understory of young,  dense stands may not survive for more than 5 years but many of  the seedlings under stands averaging 25 cm (10 in) d.b.h. or more  will persist, although they will have little annual height growth  until released. In a study of reproduction in old growth stands  cut to various basal area densities, number of seedlings per  hectare did not differ significantly at either 2 or 5 years after  cutting. After 10 years, seedlings under the lightest overstories  (6.9 m²/ha or 30 ft²/acre) grew most rapidly although  seedlings were abundant under all overstory densities (109).

    In the drier Lake States region, natural seedlings must have  overstory shade for survival until they reach 0.6 to 1.2 m (2 to  4 ft) in height, at which time their root systems have developed  from the litter-mineral soil interface into mineral soil. The  entire overstory can then be removed with high seedling survival  and full stocking (42). Removing the over-story before  seedlings are established usually results in semipermanent  wildlife openings in the Lake States (112). In partially  cut stands, the tallest seedlings usually develop and constitute  the trees of the new stand as the overstory is gradually removed(78).

    Planting or other special regenerative measures are rarely needed  for sugar maple in New England or the Lake States where the tree  grows naturally. In other regions, sugar maple is less aggressive  and planting is a desirable practice. Nursery stock used in  planting is usually fall sown at a depth of about 6 mm (0.25 in)  and covered with about 6 mm (0.25 in) of sawdust. The nursery bed  is covered by about 50 percent lath shade. Sowing density should  yield about 130 to 160 seedlings per square meter (12 to 15  seedlings/ft²) and seedlings should be vertically root  pruned before lifting, usually as 2-0 stock (101,121,124).  On more difficult sites 3-0 stock is preferred with tops  averaging about 25 cm (10 in) or about twice the height of 2-0  seedlings (101).

    Open field plantings with sugar maple have a high survival rate,  but seedlings grow poorly because of their inability to compete  for moisture and nutrients with herbaceous vegetation. Generally,  open field plantings require good stock and several years of site  maintenance to assure success (114,127). Time of planting  is important. Survival and growth can be vastly improved by  planting very early in the spring compared to planting late in  the spring. The increase is attributed to the greater root  regeneration capabilities during that time (118). Fall  plantings have been highly successful in Vermont (127). Sugar  maple must be planted at relatively close spacings in order to  correct the forking problems that result from the frequent loss  of the terminal bud in this opposite-branched species (78,89).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Seed Production and Dissemination

The fruit of  sugar maple is intermediate in size among species within the  genus. Samaras average about 15,400/kg (7,000/lb), but range from  7.060 20,070/kg (3,200 to 9,100/lb) (85). The large  papery wings, typically 20 to 27 mm (0.8 to 1.1 in) in length and  7 to 11 mm (0.3 to 0.4 in) wide, permit the samara to be carried  at least 100 m (330 ft) by the wind. During a good seed year in  northern Michigan, 173,000 samaras per hectare (70,000/acre) fell  in the center of a 4-ha (10-acre) clearcut (31). Samaras  containing seed can be readily separated from empty samaras by  immersion in N-pentane. Immersion up to 1 hour may delay  germination but has no effect on seed viability (124).

    Light fruit crops are produced by 40- to 60-year-old trees with 20  cm (8 in) d.b.h., and moderate crops by 70- to 100-year-old trees  with 25- to 36-cm (10- to14-in) d.b.h. Saw-log-size trees produce  vast numbers of samaras. During an excellent fruiting year in  northern Michigan, a series of traps caught 22 million/ha (8.56  million/acre) sugar maple samaras in a virgin stand and 11  million/ha (4.3 million/acre) in a selectively cut stand (30).

    Based on 32 years of observation in northcentral Wisconsin, good  or better fruit crops occurred about 44 percent of the years, the  lowest percentage among the major hardwood species of the area  (37;40). Good or better fruit crops occurred as often as  4 successive years, but successive poor crops did not extend  longer than 2 years. The period between good or better crops  ranges from 1 to 4 years in north-central Wisconsin, from 2 to 5  years in other portions of the United States, and from 3 to 7  years in Canada(30,47; 115).

    To germinate, sugar maple seeds require moist stratification at  temperatures slightly above freezing for 35 to 90 days. Each  sugar maple seed seems to have its own stratification-period  threshold, short of which the epigeal germination process ceases  (126). Both moisture content and temperature affect how  long seeds can be stored. Under proper conditions seeds have been  stored for at least 5 years without loss of viability (10).  In natural stands, few if any seeds remain viable on the  forest floor beyond the first year (73).

    Sugar maple seed has an extremely high germination capacity, with  averages of 95 percent or more (126). The optimum  temperature for germination is about 1° C (34° F),  the lowest of any known forest species (39,108). Germination  drops rapidly as temperatures increase, and little if any  germination occurs above 10° C (50° F). Rapid warming  of the surface soil in the spring of 1978 in northern Wisconsin,  for example, prevented germination from the bumper seed crop of  1977, except in a few remaining snowbanks along the roads (38).  Under natural conditions the cotyledon leaves are out and  growing before the snow is gone in the northern regions. This  unique characteristic of germination at low temperatures probably  accounts for the abundance of sugar maple regeneration under most  stand conditions in the north. Another major characteristic of  the germinating sugar maple seed is its vigorous development of a  strong radicle that has the strength and length to penetrate  heavy leaf litter and reach mineral soil during the moist period.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering and Fruiting

Sugar maple trees seldom  flower until they are at least 22 years old; flowering is heavier  at later ages. The flower buds usually begin to swell at or  slightly before the leaf buds show activity and reach full bloom  1 to 2 weeks before leaves emerge. Flowers appear between late  March and mid-May, depending on the geographic location (85).

    Flowering in sugar maple is polygamous, occurring over the entire  crown. The long-pedicelled, apetalous yellow flowers, about 6.4  cm (2.5 in) long, seem to be perfect, but usually only one sex is  functional within each flower. Both sexes are typically produced  in the upper part of the crown but only males form in the lower  part (26). In some trees, certain major limbs produce  only male and others only female flowers. The flowers of sugar  maple were thought to be bee-pollinated (30,64), but a  recent study showed that pollination occurs freely in sugar maple  without the aid of insects (28).

    The fruit, a double samara, ripens in about 16 weeks. Usually only  one of the paired samaras is filled with a single seed, typically  averaging 7 to 9 mm (0.3 to 0.4 in) in length, but occasionally  both samaras will contain seed or both will be empty. Some trees  produce triple samaras and others produce samaras with double  wings. Samaras collected from trees having the bird's-eye wood  grain characteristic showed a consistency of overlapping of the  wings, a strong union between samaras, and lighter colored wings  after drying but these characteristics have not been confirmed as  being an attribute associated with bird's-eye (32).

    Seeds are mature when the samaras turn yellowish green and have a  moisture content less than 145 percent (11,124). The  samaras begin falling about 2 weeks after they ripen, usually  just before the leaves fall.

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Growth and Yield

Early growth of sugar maple is  slow, partly because it regenerates under heavy shade. In natural  stands, the younger seedlings are sensitive to surface moisture  conditions because they have a shallow, fibrous root system that  lies between the litter-mineral soil interface of typical  podzols. With a gradual increase in light, the root systems  penetrate deeper into the mineral soil and height growth  increases.

    Growth during the pole stage is slower than for most associated  hardwood species. Height and radial growth begins at about the  same time as the buds leaf out. Height growth is completed in  about 15 weeks and radial growth in from 14 to 17 weeks,  depending on the season and locality (30). In some areas,  height growth is about 85 percent complete within 5 weeks and  cambial growth is about 80 percent complete in 8 weeks (30).

    In the Lake States, older sugar maple trees (fig. 3) in a mature  stand grew 2.5 cm (1 in) d.b.h. in 10 years (30). Maximum  diameter growth rates of individual trees in mature stands in the  Upper Peninsula of Michigan were about 7.6 cm (3 in) per decade  for 46-cm (18-in) trees, 8.9 cm (3.5 in) for 30-cm (12-in) trees,  and 10.2 cm (4 in) for 15-cm (6-in) trees (15). Growth in  second-growth stands, however, generally exceeds 5.1 cm (2 in) in  10 years for saw-log-size trees (18) and a maximum rate  in excess of 10.2 cm (4 in) has been reported (106). For  the first 30 to 40 years, sugar maples average about 30 cm (12  in) a year in height growth.

    Mature trees and stands of sugar maple reach 300 to 400 years of  age, 27 to 37 m (90 to 120 ft) in height, and 76- to 91-cm (30-  to 36-in) in d.b.h. (30). Following repeated cutting  under the uneven-aged system, age and diameter show strong linear  relation with the older ages, seldom exceeding 250 years (68,111).  Height growth usually ceases or becomes negligible at about  140 to 150 years (30). Diameter growth continues at a  decreasing rate with age and size. The largest reported sugar  maple tree, growing near Kitzmiller, MD, has a d.b.h. of 209 cm  (82.1 in), is 23.8 m (78 ft) tall, and has a crown spread of 20.1  m (66 ft) (1).

    Yields of mixed hardwood stands, but predominantly sugar maple,  range up to a maximum of 216 m3/ha (14,000 gross board feet/acre)  (30,70).

    Yields for northern hardwood stands in the Lake States are  available from estimates of average stand age and average stand  diameter (table 1). Both parameters are based on overstory trees.  Basal-area stocking of stands commonly ranges from 27.6 to 36.8 m²/ha  (120 to 160 ft²/acre). A few older stands exceed 45.9 m²/ha  (200 ft²/acre). Even-age and uneven-age silvicultural  systems are available for managing stands in which sugar maple is  a principal component and a desired species. Periodic annual  growth averaging about 4.2 mi/ha (350 fbm/acre) and annual  basal-area growth of up to 0.7 m²/ha (3 ft²/acre) is  typical of young stands on good sites in the Lake States but  varies with total basal-area stocking, distribution of trees by  size class, and site (18). Improvement in grade and tree  size should be the guiding principle in stand management because  this factor contributes more to value increase than diameter  growth under most conditions (41,75,105).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Sugar maple is a genetically variable tree. Some botanists  recognize from three to six varieties or forma that differ in  morphological characteristics, but others consider them to be  subspecies. Extensive research indicates a "flow of  characteristics" over the wide geographic distribution and  variation in habitat conditions (30,64). Kriebel  indicated that sugar maples could be grouped into three major  geographic races or ecotypes, each containing a parallel clinal  variation (30). Provenance tests in his study indicate  differences in drought endurance, resistance to leaf injury from  high insolation, and phenological behavior.

    Most of the genetic work in sugar maple is currently confined to  improving maple syrup (27) and developing ornamental  trees (49,62,119). Nurserymen rely mostly on budding and  some grafting for vegetative propagation. Bird's-eye grain trees  have been grafted since the early 1960's but results are not  available for propagation of this characteristic (63). The  USDA Forest Service, in recent work, has selected 228 superior  sugar maple trees and established three plantations with 126  families (43).

    Hybrids have been reported between sugar maple and black and red  maples (30). Hybrid seedlings have been obtained by  pollinating sugar maple with another maple (presumably Acer  macrophyllum) (30).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Acer saccharum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATAGGGACTCTATATTTCATCTTCGGTGCCATTGCAGGAGTGATGGGCACATGCTTCTCAGTACTGATTCGTATGGAATTAGCACGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTTTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTGATAGGTGCACCTGACATGGCATTTCCGCGATTAAATAATATTTCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCTCAGCCTTAGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCAGGAGGAGCAGTTGATTCAGCAATTTCTAGTCTTCATCTATCTGGTGTTTCATCCATTTTAGGTTCTATCAATTTTATAACAACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTATTTGTGTGGTCCGTTCTAGTGACAGCATTCCCACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACCATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCCGCTGGAGGGGGAGACCCCATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acer saccharum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Sugar maple is listed as rare in South Dakota where it is at the western
edge of its range [35].
  • 35. Houtcooper, Wayne C.; Ode, David J.; Pearson, John A.; Vandel, George M., III. 1985. Rare animals and plants of South Dakota. Prairie Naturalist. 17(3): 143-165. [1198]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, abundant tree species of the eastern and midwestern United States, often becoming the dominant or co-dominant tree in the forest canopy over large areas, particularly in the Appalachians and the Midwest.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: Relatively broad habitat amplitude (although doing best on mesic but not hydric soils), in a wide climatic range over a host of bedrock types, including glaciated areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status, such as, state noxious status, and wetland indicator values.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: MOre or less stable, with colonization of abandoned farmland or maturing forest lands counterbalancing losses from land clearing for development.

Global Long Term Trend: Decline of 30-50%

Comments: Lost many individuals (and entire stands) to 19th-century agricultural clearing and to continued development in the 20th and early 21st centuries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Relatively unthreatened. Harvested commercially for its high-quality wood, but generally selectively with younger trees able to fill gaps. Losses due to development (often in forested abandoned farmland) have local impact but do not appear to be eliminating the species from substantial areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the terms: hardwood, series

Damage:  Sugar maple is susceptible to wind damage and to damage caused
by ice storms and winter freezes [11,30].  De-icing salts often damage
sugar maples which grow along roadways.  Individuals within the
overstory are susceptible to air pollutants such as sulfur oxides,
nitrogen oxides, chlorides, and fluorides [30].  Sugar maple is
susceptible to logging injuries which frequently permit the entrance of
decay [30].

Insects/disease:  Sugar maple is host to numerous insects including bud
miners, aphids, borers, and defoliators such as the gypsy moth, tent
caterpillar, linden looper, and cankerworms [2,30].  Cankers, root rot
(Armillaria spp.), and wilt also affect sugar maple.  Since the early
1900's, this species has been periodically affected by a condition known
as maple decline [52].  Increases in die-back have been observed in many
parts of the Northeast since 1982 [34].  Causes of maple decline are
unknown, but acid rain and other pollutants are possible contributors
[74].  Trees already weakened by pollutants may be increasingly
susceptible to root rot and tent caterpillar infestations [34].  Maple
decline may be accentuated by a series of unusual climatic events; large
diameter trees are most susceptible [37].

Silviculture:  Past exploitation has resulted in the degradation of many
sugar maple stands [19].  However, in some areas, high-grading of oaks,
hickories, and walnuts, has actually produced a proportional increase in
sugar maple [12].  Shelterwood harvests and progressive strip cut
methods are often applied to mixed hardwood stands which include maple
[31,50].  For best growth of sugar maple, the residual canopy left after
the first shelterwood cut should admit approximately 40 percent light
[31].  A two-cut shelterwood system "cannot guarantee natural
regeneration" in stands which are less than 40 years in age.

Chemical control:  In general, sugar maple is resistant to foliar
herbicides [25].  Studies indicate that Tordon may be effective in
controlling sugar maple [25].
  • 2. Allen, Douglas C. 1987. Insects, declines and general health of northern hardwoods: issues relevant to good forest management. In: Nyland, Ralph D., editor. Managing northern hardwoods: Proceedings of a silvicultural symposium; 1986 June 23-25; Syracuse, NY. Faculty of Forestry Miscellaneous Publication No. 13 (ESF 87-002); Society of American Foresters Publication No. 87-03. Syracuse, NY: State University of New York, College of Environmental Science and Forestry: 252-285. [10659]
  • 11. Croxton, W. C. 1939. A study of the tolerance of trees to breakage by ice accumulation. Ecology. 20: 71-73. [5993]
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 19. Ellis, Robert C. 1979. Response of crop trees of sugar maple, white ash, and black cherry to release and fertilization. Canadian Journal of Forestry. 9(2): 179-188. [12508]
  • 25. Garrett, H. E.; Thomas, M. W.; Pallardy, S. G. 1989. Susceptibility of sugar maple and oak to eleven foliar-applied herbicides. In: Rink, George; Budelsky, Carl A., eds. Proceedings, 7th central hardwood conference; 1989 March 5-8; Carbondale, IL. Gen. Tech. Rep. NC-132. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 81-85. [9371]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 31. Godman, Richard M.; Tubbs, Carl H. 1973. Establishing even-age northern hardwood regeneration by the shelterwood method--a preliminary guide. Res. Pap. NC-99. St. Paul, MI: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 9 p. [11372]
  • 34. Hendershot, W. H.; Jones, A. R. C. 1989. Maple decline in Quebec: a discussion of possible causes and the use of fertilizers to limit damage. The Foresty Chronicle. August: 280-287. [9332]
  • 37. Houle, Gilles. 1990. Growth patterns of sugar maple seedlings and mature trees in healthy and in declining hardwood stands. Canadian Journal of Forestry Research. 20: 849-901. [12112]
  • 50. Martin, C. Wayne; Hornbeck, James W. 1990. Regeneration after strip cutting and block clearcutting in northern hardwoods. Northern Journal of Applied Forestry. 7: 65-68. [11784]
  • 52. Mueller-Dombois, Dieter; Canfield, Joan E.; Holt, R. Alan; Buelow, Gary P. 1983. Tree-group death in North American and Hawaiian forests: a pathological problem or a new problem for vegetative ecology? Phytocoenologia. 11(1): 117-137. [7852]
  • 74. Vogelmann, H. W.; Badger, G. J.; Bliss, M.; Klein, R. M. 1985. Forest decline on Camels Hump, Vermont. Bulletin of the Torrey Botanical Club. 112(3): 274-287. [10398]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

This species is readily available through local nursuries.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sugar maples are not particularly good street trees, because they are intolerant of compacted soil, high heat, air pollution, and road salt commonly found in urban environments. They are susceptible to stem and root injury, and verticillum wilt may occur when grown in heavy, poorly drained soils. “Maple decline,” periodic die-backs of relatively large trees in the Northeast, has been attributed to acid rain and other air pollutants, particularly in the last two decades, but its exact causes are not understood.

Even light ground fires may damage the thin bark of sugar maple. Hot fires can kill an entire stand and existing regeneration. The trees sprout poorly after fire. Although communities with sugar maple are relatively resistant to ground fires, a fire hazard may occur in dry years during October, after the leaves have fallen.

Seed can propagate sugar maple; early spring plantings generally produce the best results. Nurserymen usually rely on budding or grafting or sometimes use air layering or rooting of stem cuttings. Use stem tips 35-55 centimeters long taken in mid June with fully elongated bottom leaves; rooting occurs in 4-6 weeks under mist in a 2:1:1 mixture of sandy loam, vermiculite, and peat moss.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

Sugar maple is the primary source of maple sugar and syrup [30].  The
maple syrup industry is important throughout much of eastern North
America and accounted for more than 100 million dollars in trade during
1989 [34].  Maple sugar and syrup were used as trade items by many
Native American peoples [75].  Sugar maple is an attractive shade tree
and is widely planted as an ornamental [42,54].  It is sometimes used in
shelterbelt plantings [54].
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 34. Hendershot, W. H.; Jones, A. R. C. 1989. Maple decline in Quebec: a discussion of possible causes and the use of fertilizers to limit damage. The Foresty Chronicle. August: 280-287. [9332]
  • 42. Kriebel, H. B.; Gabriel, W. J. 1969. Genetics of sugar maple. Res. Pap. WO-7. Washington, DC: U.S. Department of Agriculture, Forest Service.17 p. [12750]
  • 54. Olson, David F., Jr.; Gabriel, W. J. 1974. Acer L. maple. In: Schopmeyer, C. S., technical coordinator. Seeds of woody plants in the United States. Agric. Handb. 450. Washington, DC: U.S. Department of Agriculture, Forest Service: 187-194. [7462]
  • 75. Voss, Edward G. 1985. Michigan flora. Part II. Dicots (Saururaceae--Cornaceae). Bull. 59. Bloomfield Hills, MI: Cranbrook Institute of Science; Ann Arbor, MI: University of Michigan Herbarium. 724 p. [11472]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

Sugar maple has potential value for rehabilitation of disturbed sites.
It can be propagated by seed, which averages 7,000 per pound (15,400/kg)
[30].  Early spring plantings generally produce the best results [30].
Sugar maple can also be propagated vegetatively by budding, grafting,
air-layering, or by rooting stem cuttings [30,42].
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 42. Kriebel, H. B.; Gabriel, W. J. 1969. Genetics of sugar maple. Res. Pap. WO-7. Washington, DC: U.S. Department of Agriculture, Forest Service.17 p. [12750]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Value

Numerous species of songbirds nest in sugar maple.  Cavity nesters such
as the black-capped chickadee excavate nest cavities or utilize
preexisting cavities [33].  The common flicker, pileated woodpecker, and
screech owl also nest in maples [33].
  • 33. Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 23 p. [13859]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

Sugar maple is commonly browsed by white-tailed deer, moose, and
snowshoe hare [31,53,71].  In Nova Scotia and New Brunswick,
white-tailed deer and snowshoe hare use is heaviest during the winter
[71].  The red squirrel, gray squirrel, and flying squirrels feed on the
seeds, buds, twigs, and leaves of sugar maple [30].  The porcupine
consumes the bark and can, in some instances, girdle the upper stem
[30].
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]
  • 31. Godman, Richard M.; Tubbs, Carl H. 1973. Establishing even-age northern hardwood regeneration by the shelterwood method--a preliminary guide. Res. Pap. NC-99. St. Paul, MI: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 9 p. [11372]
  • 71. Telfer, Edmund S. 1972. Browse selection by deer and hares. Journal of Wildlife Management. 36(4): 1344-1349. [12455]
  • 53. Newton, Michael; Cole, Elizabeth C.; Lautenschlager, R. A.; [and others]. 1989. Browse availability after conifer release in Maine's spruce-fir forests. Journal of Wildlife Management. 53(3): 643-649. [8401]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wood Products Value

Sugar maple wood is tough, durable, hard, heavy, and strong [36,68].  It
is well suited for many uses and is commonly used to make furniture,
paneling, flooring, and veneer [18,42].  It is also used for gunstocks,
tool handles, plywood dies, cutting blocks, woodenware, novelty
products, sporting goods, bowling pins, and musical instruments
[12,36,42].
  • 68. Stephens, H. A. 1973. Woody plants of the North Central Plains. Lawrence, KS: The University Press of Kansas. 530 p. [3804]
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 18. Duncan, Wilbur H.; Duncan, Marion B. 1988. Trees of the southeastern United States. Athens, GA: The University of Georgia Press. 322 p. [12764]
  • 36. Hosie, R. C. 1969. Native trees of Canada. 7th ed. Ottawa, ON: Canadian Forestry Service, Department of Fisheries and Forestry. 380 p. [3375]
  • 42. Kriebel, H. B.; Gabriel, W. J. 1969. Genetics of sugar maple. Res. Pap. WO-7. Washington, DC: U.S. Department of Agriculture, Forest Service.17 p. [12750]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

The preference is full sun to light shade, well-drained mesic conditions, and a fertile loamy soil, although soil containing rocky material, sand-loam, silt-loam, or clay-loam is also tolerated. Young saplings of Sugar Maple are able to survive in moderately dense shade, although higher levels of light are preferred. Generally, this tree doesn't tolerate flooded conditions for any substantial length of time. Sugar Maple is somewhat susceptible to air pollution (including acid rain), road salt, ice damage, and wind-throw. It often casts a dense shade that kills turf grass and other vegetation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nutritional Value

The nutrient content of sugar maple browse varies by plant part and by
phenological development [15].  Starch content is highest in early fall
and lowest in winter.  Sugar maple leaves average 1.81 percent calcium,
0.25 percent magnesium, 0.75 percent potassium, 0.11 percent phosphorus,
0.67 percent nitrogen, and 11.85 percent ash by dry weight [30].  Unlike
many plants, the leaves of sugar maple typically contain relatively high
levels of calcium, magnesium, and potassium when they are shed in autumn
[12].
  • 12. Curtis, John T. 1959. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press. 657 p. [7116]
  • 15. Donnelly, John R. 1976. Carbohydrate levels in current-year shoots of sugar maple. Res. Pap. NE-347. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 6 p. [11790]
  • 30. Godman, Richard M.; Yawney, Harry W.; Tubbs, Carl H. 1990. Acer saccharum Marsh. sugar maple. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Vol. 2. Hardwoods. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 78-91. [13957]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palatability

Sugar maple is at least somewhat palatable to deer in most areas.
Samaras are palatable to squirrels and many other small mammals.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Special Uses

The sugar maple tree is the principal source of maple sugar. The  trees are tapped early in the spring for the first flow of sap,  which usually has the highest sugar content. The sap is  collected and boiled or evaporated to a syrup. Further  concentration by evaporation produces the maple sugar. Sugar  maple sap averages about 2.5 percent sugar; about 129 liters (34  gal) of sap are required to make 3.8 liters (1 gal) of syrup or  3.6 kg (8 lb) of sugar. Guides have been printed for developing a  sugar bush from natural stands (67).

    Breeding experiments have determined that sugar content is high  for certain families and that sugar content in individual trees  is consistent over a period of years (64,104). A sugar  content of 7.4 percent has been attained by crossing two selected  parents of slightly lower content (64). The sugar content  is also correlated with the volume yield of sap (7,74).

  • Burns, Russell M., and Barbara H. Honkala, technical coordinators. 1990. Silvics of North America: 1. Conifers; 2. Hardwoods.   Agriculture Handbook 654 (Supersedes Agriculture Handbook 271,Silvics of Forest Trees of the United States, 1965).   U.S. Department of Agriculture, Forest Service, Washington, DC. vol.2, 877 pp.   http://www.na.fs.fed.us/spfo/pubs/silvics_manual/table_of_contents.htm External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard M. Godman

Source: Silvics of North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Sugar maple is the only tree today used for commercial syrup production, as its sap has twice the sugar content of other maple species. The sap, mostly collected in the spring, is concentrated by boiling or reverse osmosis, with about 35-40 liters of sap making 1 liter of syrup. A single tree may produce 5-60 liters of sap per year. Nights below freezing and days at higher than 5°C are needed to ensure good sap flow. Sugar maple was the premier source of sweetener, along with honey, to Native Americans and early European settlers. Native Americans also used sugar maple sap for sugar and candies, as a beverage, fresh or fermented into beer, and soured into vinegar and used to cook meat.

Sugar maple is widely planted as an ornamental or shade tree and many cultivars have been selected, based on variation in growth habit/crown shape, mature height, fall color, leaf shape, and temperature tolerance. The leaves go from green to brilliant yellow, orange, and red in autumn, although there is much variation in fall color within the species. Orange and reds seem to be more intense in New England types, while yellows are more pronounced further west. Interior leaves may be yellow, while outer exposed leaves turn orange-red. The species is

best suited to larger sites where soil compaction is not a concern. It also is sometimes used in shelterbelt plantings and has potential value for rehabilitation of disturbed sites.

Sugar maple is an important timber tree valued for its hard, heavy, and strong wood, commonly used to make furniture, paneling, flooring, and veneer. It is also used for gunstocks, tool handles, plywood dies, cutting blocks, woodenware, novelty products, sporting goods, bowling pins, and musical instruments.

White-tailed deer, moose, and snowshoe hare commonly browse sugar maple. Red squirrel, gray squirrel, and flying squirrels feed on the seeds, buds, twigs, and leaves. Porcupines consume the bark and can girdle the upper stem. Songbirds, woodpeckers, and cavity nesters nest in sugar maple. Although the flowers appear to be wind-pollinated, the early-produced pollen may be important to the biology of bees and other pollen-dependent insects because many insects, especially bees, visit the flowers.

Public Domain

USDA NRCS National Plant Data Center & the Biota of North America Program

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acer saccharum

Acer saccharum (sugar maple) is a species of maple native to the hardwood forests of northeastern North America, from Nova Scotia west to southern Ontario, and south to Georgia and Texas.[2] Sugar maple is best known for its bright fall foliage and for being the primary source of maple syrup.

Contents

Description [edit]

Bark

Acer saccharum is a deciduous tree normally reaching heights of 25–35 m (82–115 ft) tall,[3][4] and exceptionally up to 45 m (148 ft).[5] A 10-year-old tree is typically about 5 m (16 ft) tall.

The leaves are deciduous, up to 20 cm (7.9 in) long and equally wide,[3] with five palmate lobes. The basal lobes are relatively small, while the upper lobes are larger and deeply notched. In contrast with the angular notching of the silver maple, however, the notches tend to be rounded at their interior. The fall color is often spectacular, ranging from bright yellow through orange to fluorescent red-orange. Sugar maples also have a tendency to color unevenly in fall. In some trees, all colors above can be seen at the same time. They also share a tendency with red maples for certain parts of a mature tree to change color weeks ahead of or behind the remainder of the tree. The leaf buds are pointy and brown-colored. The recent year's growth twigs are green, and turn dark brown.

Samara

The flowers are in corymbs of five to 10 together, yellow-green and without petals; flowering occurs in early spring after 30-55 growing degree days. The fruit is a double samara with two winged seeds, the seeds are globose, 7–10 mm (0.28–0.39 in) in diameter, the wing 2–3 cm (0.79–1.2 in) long. The seeds fall from the tree in autumn, where they must be exposed to 90 days of sub-40°F temperatures to break their coating down. Germination of A. saccharum is slow, not taking place until the following spring when the soil has warmed and all frost danger is past.[6]

It is closely related to the black maple, which is sometimes included in this species, but sometimes separated as Acer nigrum. The western American bigtooth maple (Acer grandidentatum) is also treated as a variety or subspecies of sugar maple by some botanists.

The sugar maple is also often confused with the Norway maple, though they are not closely related within the genus. The sugar maple is most easily identified by clear sap in the leaf petiole (the Norway maple has white sap), brown, sharp-tipped buds (the Norway maple has blunt, green or reddish-purple buds), and shaggy bark on older trees (the Norway maple bark has small grooves). Also, the leaf lobes of the sugar maple have a more triangular shape, in contrast to the squarish lobes of the Norway maple.

Although many people think a red sugar maple leaf is featured on the flag of Canada, the official maple leaf does not belong to any particular maple tree. Instead, it was specially designed to be as identifiable as possible on a flag waving in the wind.[7]

Ecology [edit]

Sugar maple-yellow birch forest, Jacques-Cartier National Park, Quebec, Canada

The sugar maple is an extremely important species to the ecology of many forests in North America. Pure stands are common, and it is a major component of the northern and central U.S. hardwood forests. In the north, it forms associations of beech-maple and sugar maple-yellow birch, which is most important beyond the northern limit of beech. Sugar maple-American basswood, sugar maple-white ash and sugar maple-ironwood--red oak are also common forest associations.

Sugar maple is among the most shade tolerant of large deciduous trees. Among North American maples, its shade tolerance is exceeded only by the striped maple, a smaller tree. Like other maples, its shade tolerance is manifested in its ability to germinate and persist under a closed canopy as an understory plant, and respond with rapid growth to the increased light formed by a gap in the canopy. The sugar maple can grow comfortably in any type of soil, except sand.

Sugar maples engage in hydraulic lift, drawing water from lower soil layers and exuding that water into upper, drier soil layers. This not only benefits the tree itself, but also many other plants growing around it.[8]

Human influences have contributed to the decline of the sugar maple in many regions. Its role as a species of mature forests has led it to be replaced by more opportunistic species in areas where forests are cut over. The sugar maple also exhibits a greater susceptibility to pollution than other species of maple. Acid rain and soil acidification are some of the primary contributing factors to maple decline. Also, the increased use of salt over the last several decades on streets and roads for deicing purposes has decimated the sugar maple's role as a "street-front" tree.

In some parts of eastern North America, particularly near urbanized areas, the sugar maple is being displaced by the Norway maple. The Norway maple is also highly shade tolerant, but is considerably more tolerant of urban conditions, resulting in the sugar maple's replacement in those areas heavily disturbed by human activities. In addition, Norway maple produces much larger crops of seeds, allowing it to out-compete native species.

Cultivation and uses [edit]

Collecting sap from sugar maples
Autumn color change
Foliage and fruit of Acer platanoides for comparison, commonly misidentified as A. saccharum. The fruit are much larger and different in shape.

The sugar maple is one of the most important Canadian trees, being, with the black maple, the major source of sap for making maple syrup.[9] Other maple species can be used as a sap source for maple syrup, but some have lower sugar contents and/or produce more cloudy syrup than these two.[9]

The wood is one of the hardest and densest of the maples, 740 kg/m3 (46 lb/cu ft),[10] and is prized for furniture and flooring. The sapwood can be white in color, and smaller logs may have a higher proportion of this desirable wood.[11] Bowling alleys and bowling pins are both commonly manufactured from sugar maple. Trees with wavy woodgrain, which can occur in curly, quilted, and "birdseye maple" forms, are especially valued. Maple is also the wood used for basketball courts, including the floors used by the NBA, and it is a popular wood for baseball bats, along with white ash. It is also widely used in the manufacture of musical instruments, such as the members of the violin family (sides and back), guitars (neck), and drum shells. It is also quite flexible and makes excellent archery bows.

Canadian maple, often referred to as "Canadian hardrock maple", is prized for pool cues, especially pool cue shafts, and the highest grades of this white wood are used by virtually all (both production line and custom hand-made) cue makers to make high-quality shafts. Some production-line cues will use lower-quality Canadian maple wood with cosmetic issues, such as "sugar marks", which are (most often) light brown discolorations visible on the shaft caused by sap in the wood. Great shaft wood has a very consistent grain, and no marks or discoloration. Sugar marks usually do not affect how the cue plays, but are not as high quality as those without it. This wood is also used in skateboard decks for its strength.

The sugar maple was a favorite street and park tree during the 19th century because it was easy to propagate and transplant, is fairly fast-growing, and has beautiful fall color. As noted above however, it proved too delicate to continue in that role after the rise of automobile-induced pollution and was replaced by Acer Platanoides and other hardier species. The shade and the shallow, fibrous roots may interfere with grass growing under the trees. Deep, well-drained loam is the best rooting medium, although sugar maples can grow well on sandy soil which does not become excessively dry. Light (or loose) clay soils are also well known to support sugar maple growth. Poorly drained areas are unsuitable, and the species is especially short-lived on flood-prone clay flats. Its salt tolerance is low and it is very sensitive to boron.

Cultivars
  • 'Apollo' - columnar
  • 'Arrowhead' - pyramidal crown
  • 'Astis' ('Steeple') - heat-tolerant, good in southeastern USA, oval crown
  • 'Bonfire' - fast growing
  • 'Caddo' - naturally occurring southern ecotype, great drought and heat tolerance, good choice for the Great Plains region
  • 'Columnare' ('Newton Sentry') - very narrow
  • 'Fall Fiesta' - tough-leaved, colorful in season, above-average hardiness
  • 'Goldspire' - columnar with yellow-orange fall color
  • 'Green Mountain' (PNI 0285) - durable foliage resists heat and drought, oval crown, very hardy (cold tolerance may match 'Unity')
  • 'Legacy' - tough, vigorous and popular
  • 'Monumentale' - columnar
  • 'Sweet Shadow' - lacy foliage
  • 'Temple's Upright' - almost as narrow as 'Columnare'
  • 'Unity' - one of hardiest cultivars, from Manitoba

The sugar maple is the state tree of the US states of New York, Vermont, West Virginia and Wisconsin.

Leafless sugar maples in Vermont state quarter

In popular culture [edit]

The sugar maple is depicted on the state quarter of Vermont, issued in 2001.

See also [edit]

References [edit]

  1. ^ Stevens, P. F. (2001 onwards). Angiosperm Phylogeny Website. Version 9, June 2008 [and more or less continuously updated since]. mobot.org
  2. ^ Germplasm Resources Information Network: Acer saccharum
  3. ^ a b Northern Ontario Plant Database: Acer saccharum
  4. ^ Oklahoma Biological Survey: Acer saccharum
  5. ^ "GSMNP tall trees". Nativetreesociety.org. Retrieved 2011-03-03. 
  6. ^ Lawrence O. Copeland; M. B. McDonald (31 October 2001). Principles of seed science and technology. Springer. pp. 194–. ISBN 978-0-7923-7322-3. Retrieved 25 September 2010 
  7. ^ http://www.canadianheritage.gc.ca/progs/cpsc-ccsp/sc-cs/df1_e.cfm
  8. ^ "Hydraulic lift and its influence on the water content of the rhizosphere: an example from sugar maple, Acer saccharum". Springerlink.com. Retrieved 2011-03-03. 
  9. ^ a b Heilingmann, Randall B. "Hobby Maple Syrup Production (F-36-02)". Ohio State University. 
  10. ^ Hard Maple published by Niche Timbers
  11. ^ Daniel L. Cassens. "Hard or sugar maple". Purdue University:Purdue Extension. 
  • Horton, J. L.; Hart, S.C. (1998). "Hydraulic lift: a potentially important ecosystem process". Trends in Ecology and Evolution 13 (6): 232–235. doi:10.1016/S0169-5347(98)01328-7. PMID 21238277. 
  • Canham, C. D. (1989). "Different Respones to Gaps Among Shade-Tolerant Tree Species". Ecology 70 (3): 548–550. doi:10.2307/1940200. 
  • Brisson, J., Bergeron, Y., Bouchard, A., & Leduc, A. (1994). Beech-maple dynamics in an old-growth forest in southern Quebec, Canada. Ecoscience (Sainte-Foy) 1 (1): 40-46.
  • Duchesne, L.; Ouimet, R.; Houle, D. (2002). "Basal Area Growth of Sugar Maple in Relation to Acid Deposition, Stand Health, and Soil Nutrients". Journal of Environmental Quality 31 (5): 1676–1683. doi:10.2134/jeq2002.1676. PMID 12371186. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The sugar maple and the black maple are treated by Kartesz (1994, 1999) as different species (Acer saccarum and Acer nigrum, respectively); they are sometimes considered to be subspecies or varieties of the same species (in which case the name Acer saccharum has nomenclatural priority, with the black maple being called Acer saccharum ssp. nigrum or Acer saccharum var. nigrum). Note that the species Acer saccharinum (silver maple) has a similar name.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The word “Acer” is derived from a Latin word meaning “sharp,” referring to the characteristic points on maple leaves. It was first applied to the genus by the French botanist Joseph Pitton de Tournefort in 1700. The species epithet, "saccharum," is from the Greek "saccharin," for sugar.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Jacqueline Courteau, modified from Wikipedia.

Supplier: Jacqueline Courteau

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!