Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Biology

Adults of this anadromous species migrate up rivers in March and April, but spawning actually takes place the following year between May and July (4). Mating occurs in pairs, unlike the other lampreys in which a female is mated by a succession of males (4). The female lays up to 300,000 eggs into a depression in the river bed created by the male. After hatching, the larvae, known as ammocoetes burrow into the sediment where they live for three to five years, feeding by filtering organic particles from the water (4). During metamorphosis, the eyes and the sucker-like mouth develop and the adults then migrate to the sea where they adopt a parasitic lifestyle, feeding by attaching to the bodies of large fish with the mouth and rasping away at the flesh. They remain in the sea for a few years and then return to freshwater in order to spawn. They do not feed during this return trip because the digestive organs degenerate, and shortly after spawning they die (4). Roman, Viking and Medieval Britons regarded river and sea lampreys as delicacies (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Lampreys are some of the most primitive vertebrates alive today, they are known as cyclostomes, which means 'round mouths' and refers to the fact that they are jawless, having instead a round sucker-like mouth. A further primitive characteristic is that the skeleton consists of cartilage and not bone (2). Lampreys are similar in shape to eels, and have a series of uncovered round gill openings (known as gill pores) on the sides of the head and a single nostril on the upper surface of the head (2). The sea lamprey is the largest cyclostome in Europe. It can be distinguished from the other lampreys by its larger size, the marbling of the greyish-green back, and the two dorsal fins, which are widely separated (4). An alternative common name is 'stone sucker' (5), which may have arisen from the habit of males during spawning, when they create a depression in the river bed by wriggling and removing stones with the mouth (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Just like other lampreys, sea lampreys have a monstrous suction mouth with rows of small grating teeth. Using these teeth, they clamp onto large fish to suck their blood. This is necessary for survival. They attach themselves so tightly that the victims are not usually able to shake them off, despite the suffering they incur from these parasitic fish. The wounds made by the lampreys can cause death in the victims. Sea lampreys are born in fresh water. They live in the mud as larva for several years. Only after maturing do they move to the sea, only returning to the river to lay eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Lampreys belong to a group of vertebrates known as Agnatha which means 'jawless fish'. Their mouth is a toothed circular sucking disk. They have long elongated eel-like bodies. They can also be recognised by their gills which open directly to each side of the head in the form of a line of seven gill holes behind the eye. The back and sides of Petromyzon marinus have a distinctly mottled colour pattern with a brown-yellow dorsal and lateral colouring. It usually reaches over 50 cm in length.Relatively easily distinguished from the river lamprey Lampetra fluviatilis and the brook lamprey Lampetra planeri by its considerably larger size and distinctly mottled colour pattern (Igoe et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Amphihaline species making important migrations. Spends its adult life in the sea for about 20-36 months, moving further offshore as it grows (Ref. 59043). Adults are parasitic, using their sharp teeth to attach themselves to cetaceans and large fish and feed off their host’s blood, body fluids and flesh for several days, usually without killing the host (Ref. 59043). An anticoagulant substance prevents the blood of the prey from clotting. Mature adults enter rivers and streams to spawn in spring (Ref. 12324, 35387, 88186). Movements from the sea to spawning sites may cover distances from 20-850 km inland (Ref. 12324). After spawning adults normally die (Ref. 51442). Ammocoetes drift downstream and bury in detritus-rich mud, silt or sand-silt bottoms (Ref. 59043, 88712) for 5.5-8 years, often at the edges of rivers and streams where currents are slow (Ref. 58185, 59043, 88184). Ammocoetes are filter feeders of diatoms and detritus (Ref. 30578, 51442, 59043). Upon metamorphosis, individuals move downstream towards the sea. Juveniles remain in the estuaries and shallow coastal areas for a feeding period lasting 23-28 months, during which they grow from ca. 4 to 900 g (Ref. 58185, 88171). The may not only feed on dead or netted fish, but also attach themselves to healthy fish. The landlocked form is very destructive to freshwater fishes and occasionally annoys bathers by clinging to them (Ref. 51442). Most individuals attain 60-75 cm length (Ref. 88187).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Belgian Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, IJsselmeer, North West Atlantic, Portuguese Exclusive Economic Zone, Schelde estuary, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Atlantic: Norway including Iceland and the Barents Sea, south to northern Africa. Throughout the western and central Mediterranean but absent from eastern Mediterranean and the Black Sea (Ref. 59043). Western Atlantic: Labrador, Canada to Gulf of Mexico in Florida, USA. Landlocked in Great Lakes, Finger Lakes, Oneida Lake and Lake Champlain, Canada/USA (Ref. 12269). Appendix III of the Bern Convention (2002). Annex II (excluding Swedish population) of the EC Habitats Directive (2007).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Both sides of North Atlantic, north to Iceland and along Norwegian coasts to Barents Sea (River Ura, Kola Peninsula). North Sea, Baltic and western and central Mediterranean basins, very rare in Baltic basin, only known to enter Odra, Vistula (Poland, Germany), Western Dvina (Latvia), Narova and Luga (Russia) drainages. Several landlocked populations in North America; none in Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sea lampreys are native to the Atlantic Ocean. Between the months of March and October, they can be found along the coast of the United States as far north as Massachusetts and as far south as South Carolina. In October, North American lampreys migrate south along the Atlantic coast to warmer climates, some travelling as far south as Florida. Sea lampreys can also be found along the Atlantic coast of Europe as far north as Norway and ranging as far south as the Mediterranean. In October, they can travel as far south as Africa and to parts of the Indian coast. Sea lampreys have also been introduced to the Great Lakes region of the United States many times over within the past 200 years. Reports of this species in Lake Ontario date back to the early 1800s. Great Lake sea lampreys must first travel through the Gulf of St. Lawrence in order to gain access to the Atlantic coastal region.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Native ); oriental (Native ); atlantic ocean (Introduced , Native ); mediterranean sea (Introduced , Native )

  • Jenkins, R., N. Burkhead. 1993. Freshwater Fishes of Virginia. Bethesda, Maryland: American Fisheries Society.
  • 2010. "Sea Lamprey Management Program" (On-line). U.S. Fish and Wildlife Service. Accessed September 24, 2010 at http://midwest.fws.gov/Marquette/index.html.
  • Great Lakes Fishery Commission. 2000. "The Great Lakes Fishery Commission" (On-line pdf). Sea lamprey. Accessed September 12, 2010 at http://www.seagrant.umn.edu/downloads/x106.pdf.
  • Lavis, D., A. Hallett, E. Koon, T. McAuley. 2003. History of and advances in barriers as an alternative method to suppress sea lampreys in the Great Lakes. Journal of Great Lakes Research, 29/1: 362-372.
  • Lavis, D., M. Henson, D. Johnson, E. Koon, D. Ollila. 2001. A case history of sea lamprey control in Lake Michigan: 1979 to 1999. Journal of Great Lakes Research, 29/1: 584-598.
  • Nikitina, N., M. Bronner-Fraser, T. Sauka-Spengler. 2009. The sea lamprey Petromyzon marinus: a model for evolutionary and developmental biology. Cold Spring Harb Protocols, 113: 1-39.
  • Rohde, F., R. Arndt, D. Lindquist, J. Parnell. 1994. Freshwater Fishes of the Carolinas, Virginia, Maryland, and Delaware. Chapel Hill,North Carolina: The University of North Carolina Press.
  • Trautman, M. 1981. The Fishes Of Ohio. Ohio: Ohio State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic from Labrador to Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range in the northeast Atlantic extends from Norway, Iceland, and the Barents Sea south to northern Africa, including the western Mediterranean Sea. In the northwest Atlantic, the range extends from Labrador, Canada, to the Gulf of Mexico in Florida, USA. Landlocked populations occur in the Great Lakes, Finger Lakes, Oneida Lake, and Lake Champlain. Construction of canals allowed access to Upper Great Lakes (above Lake Ontario).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Baltic Sea, Mediterranean Sea, Black Sea [formerly], European Atlantic, northwestern Atlantic, and adjacent watersheds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West coast of Greenland to Florida; northern Norway to the Mediterranean. Northeast Atlantic. Landlocked in Great Lakes, Finger Lakes, Oneida Lake and Lake Champlain, Canada/USA.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Hardisty, M.W., 1986, Billard, R., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The sea lamprey is fairly widespread in UK rivers, but it has declined to extinction in some areas. It is absent north of the Great Glen, Scotland, possibly as it prefers warm water (6). Current strongholds are the rivers Wye and Severn (2). Outside of the UK it is known from most of the Atlantic coastal areas of western and northern Europe between Norway and the Mediterranean. It is also found in eastern parts of North America (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Sea lampreys, Petromyzon marinus, belong to a group of fish called Agnathans, which lack a jaw. Although classified in the subphylum Vertebrata, this species lacks vertebrae, and their entire skeleton is cartilaginous. Commonly known for their smooth, scaleless physique and long cylindrical bodies, they are often misidentified as eels. Sea lampreys also lack swim bladders and a lateral line system. Members of this species have a visible eye spot located on each side of their head behind a single nostril and above a set of seven gill openings. Their mouth takes on an oval shape while attached to their host, but once opened it becomes larger than the head and pharynx together. Inside the oval-shaped mouth are numerous rows of large teeth pointing inward. Sea lampreys have two dorsal fins but lack any paired fins. When spawning occurs, males develop a distinct ridge along their back and females develop a pronounced fold of skin behind their vent.

Sea lampreys are the largest and most aggressive species of lamprey, ranging from 15.2 to 30 cm in length as juveniles and 30 to 100 cm in length as adults. Adults can weigh up to 2.5 kg. Besides length, there are several key differences between adult and young sea lampreys. Color is often a good indicator of age; larvae generally are dark, greenish brown with a light grey underbelly, while adults are brownish grey and tend to lighten in color when about to spawn. Another key difference involves the dorsal fins; while separate in young lampreys, the dorsal fins migrate closer together as sea lampreys reach adulthood.

Range mass: 1 to 2.5 kg.

Range length: 15.2 to 30 cm.

Other Physical Features: bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 2,500 g (Ref. 5504); max. reported age: 11 years (Ref. 12324)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 120 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 120 cm TL
  • Bigelow, H. B., and Schroeder. W.C.,1953; Hardisty, M.W., 1986, Billard, R., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Anguilliform body (Ref. 51442). Jawless with a round sucker-like mouth and sharp teeth arranged in many consecutive circular rows (Ref. 88171). Presence of 7 branchial openings behind the eye (Ref. 51442, 88171). It lacks paired fins (Ref. 88171). Number of myomeres: 67-74 (Ref. 6258). Olive or brown-yellow on the dorsal and lateral part of the body, with black marblings; becomes lighter ventrally (Ref. 35388, 51442, 58137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Petromyzon marinus
Catalog Number: USNM 33311
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Cape May To Nantucket, New Jersey, United States, Atlantic
Depth (m): 1000 to 1000
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Petromyzon marinus
Catalog Number: USNM 31368
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Belding
Locality: Cayuga Lake, New York, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 4099 m (Ref. 47198)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
Adults at sea, off-shore; spawns in strong-current habitats of rivers and streams. Ammocoetes in detritus-rich sands or clay sediments.

Biology:
Anadromous, parasitic. Adults migrate into rivers from autumn to winter. Spawns in couples in April-July, mostly in May and early June, when temperature reaches at least 15°C. Spawning individuals cease their normal daylight avoidance reaction and reproduce on sunny days. Males dig a shallow nest in habitats with strong current. Dies after spawning. Ammocoetes stage lasts 51/2-71/2 years in freshwater. Feeds on diatoms and detritus, metamorphoses at 130-150 mm TL in late summer and migrates to sea. At sea, adults parasite a wide variety of fish species and even whales and other cetaceans. Usually does not kill its hosts, but feeds on small amounts of blood and body fluid for several days on a single host. Adults feed for about 3 years before migrating to spawning grounds. In 1921, the landlocked population of Lake Ontario entered the other Great Lakes of North America, 90 years after the opening of the Welland Canal in 1829. In combination with other factors, it caused a sharp decline of many native species and the extinction of three endemic Coregonidae. Expectedly, recent molecular studies suggest that the European and North American populations might be different species.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sea lampreys are anadromous, and migration is triggered by changes in water temperature. In general, they prefer shallow coastal areas, though they are found at depths between 0.91 and 4.57 m. Young lampreys are hatched in gravel or rock beds in small, freshwater streams and rivers. After the larval stage, they migrate into saltwater ocean habitats. They return to freshwater to lay their eggs. Sea lampreys thrive in systems where the following are present: 1) waterways lacking obstructions (like dams or waterfalls) with clean sand and gravel areas for spawning; 2) sand beds free of pollutants with a large supply of organic matter for their developing young; and 3) large waterways with a plentiful supply of fish to serve as hosts for their fully developed offspring.

Range depth: 0.91 to 4.57 m.

Habitat Regions: saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous species, spends adult life in saltwater except to spawn in freshwater streams.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 321 specimens in 1 taxon.
Water temperature and chemistry ranges based on 187 samples.

Environmental ranges
  Depth range (m): 0.425 - 2100
  Temperature range (°C): 2.018 - 16.594
  Nitrate (umol/L): 2.030 - 23.693
  Salinity (PPS): 8.860 - 35.761
  Oxygen (ml/l): 2.495 - 7.049
  Phosphate (umol/l): 0.382 - 1.704
  Silicate (umol/l): 2.111 - 42.456

Graphical representation

Depth range (m): 0.425 - 2100

Temperature range (°C): 2.018 - 16.594

Nitrate (umol/L): 2.030 - 23.693

Salinity (PPS): 8.860 - 35.761

Oxygen (ml/l): 2.495 - 7.049

Phosphate (umol/l): 0.382 - 1.704

Silicate (umol/l): 2.111 - 42.456
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Adults migrate from the ocean or lake to spawning streams. Landlocked populations in lakes may migrate up to about 50 miles upstream for spawning. Anadromous populations with access to the ocean migrate up to a couple hundred miles. Females deposit numerous small eggs in nests made by males in gravel, sand, and rubble of streams with moderately strong current. Larvae burrow in sand and silt bottom in quiet water downstream from spawning areas and filter-feed on plankton and detritus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Petromyzon marinus is a demersal and anadromous species found in a wide range of riverine and offshore habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 650m.
From 1 to 650 meters.

Habitat: demersal. Lives in coastal waters. Enters river mouths for spawning in spring. Feeds on dead or netted fish but also attach themselves to healthy fish (e.g. bony fish, sharks and even marine mammals) by scraping a hole in their skin and sucking out the blood, body fluids and flesh. An anticoagluant substance prevents the blood of the prey from clotting. The landlocked form is very destructive to freshwater fishes and occasionally annoys bathers by clinging to them.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; freshwater; brackish; marine; depth range 1-650m.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Hardisty, M.W., 1986, Billard, R., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in high quality, deep, fast flowing rivers with clean gravel in which to spawn and a sandy substrate for the larvae to burrow into (6). The adults migrate out to sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Landlocked populations may migrate up to about 50 miles upstream for spawning, anadromous populations up to 200 miles (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Amphihaline species making important migrations. Spends its adult life in the sea for about 20 to 30 months. Adults enter freshwater/estuaries for spawning in spring; after spawning they normally die (Ref. 51442). The larvae are reported to spend 6-8 years in the substrate followed by metamorphosis and movement to sea. They remain in the estuarine/marine environment for a juvenile feeding period lasting 23-28 months, during which they grow from ca. 4 to 900 g; at the end of this period, they move into rivers as adults and reproduce (Ref. 58185). Larvae live in rivers where they feed on microorganisms and detritus (Ref. 30578, Ref. 51442). During juvenile feeding phase, they may not only feed on dead or netted fish, but also attach themselves to healthy fish (e.g. wide variety of bony fishes, sharks and marine mammals) by scraping a hole in their skin and sucking out the blood, body fluids and flesh. Adults are hematophageous predators of fishes (Ref. 51442). The ammocoetes-larvae is microphageous feeding mostly on diatoms (Ref. 51442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Newly hatched larval sea lampreys are freshwater filter-feeders that consume detritus, algae, and other organic material found at river bottoms. Once in a saline environment (or in the Great Lakes), sea lampreys develop parasitic abilities, attach themselves to a fish and ingest their blood and skin. Sea lampreys ultimately breaks down the fish while the fish is still alive. This species is capable of attaching itself to a variety of species of fish and does not seem to have a preference of host species. Once sea lampreys reach sexual maturity, they no longer feed.

Animal Foods: fish; blood; body fluids; carrion

Plant Foods: algae

Other Foods: detritus

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Sanguivore , Eats body fluids); herbivore (Algivore); omnivore ; detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Adults parasitic on fishes. Larvae filter-feed on plankton.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on dead or netted fish; also feed on healthy fish, sucking out the fluids and flesh by boring a hole in the flesh
  • Bigelow, H. B., and Schroeder. W.C.,1953; Hardisty, M.W., 1986, Billard, R., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Parasitic sea lampreys have a detrimental effect on fish within their ecosystem. Specifically, sea lampreys feed on salmon, lake trout, rainbow trout, whitefish, chubs, burbot, walleye, and some catfish. Fish populations as as well as those industries that depend on fish are declining. Sea lampreys have no known predators except humans. In the Great Lakes region, a small percentage of sea lampreys carried cestode parasites or roundworms during some portion of its life. Of these parasites, only roundworms caused severe damage to their lamprey hosts.

Ecosystem Impact: parasite

Species Used as Host:

Commensal/Parasitic Species:

  • Dawson, H., M. Jones. 2006. Factors affecting recruitment dynamics of Great Lakes sea lamprey (Petromyzon marinus) populations. Journal of Great Lakes Research, 32/3: 353-360.
  • Mandenjian, C., P. Cochran, R. Bergstedt. 2003. Seasonal patterns in growth, blood consumption, and effects on hosts by parasitic-phase sea lampreys in the Great Lakes: an individual-based model approach. Journal of Great Lakes Research, 29/1: 332-346.
  • Mandenjian, C., T. Desorcie. 2010. Lake Trout population dynamics in the northern refuge of Lake Michigan: implications for future rehabilitation. North American Journal of Fisheries Management, 30/3: 629-641.
  • McLain, A. 1952. Diseases and Parasites of the Sea Lamprey, Petromyzon Marinus, in the Lake Huron Basin. Transactions of the American Fisheries Society, 81/1: 94-100.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sea lampreys do not have many known predators, and their most common predator are humans. While sea lampreys in the Great Lakes region are often killed in preservation efforts of native fish, sea lampreys are also trapped in Europe, Asia, and India to be consumed and are even considered a delicacy. Many European countries capture sea lampreys and use them in a variety of dishes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

May move hundreds of miles among different Great Lakes (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication patterns of sea lampreys are not well known. It is thought male sea lampreys emit a pheromone composed of bile acids that alerts ovulating females to their presence. This signal may also be related to mating preferences and may be sent over large distances.

Other Communication Modes: pheromones

Perception Channels: visual ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Mature adults ascend rivers during spring and early summer (Ref. 35387, 88186) when water temperature ranges from 10-18°C (Ref. 88184) and gather in small groups (Ref. 5504). Behavioural experiments suggest that mature sea lampreys can smell the presence of ammocoetes and use this as a guide to functional spawning grounds (Ref. 88714). Spawning occurs in fast-flowing highly oxygenated areas with gravel, pebbles and sand bottoms (Ref. 12324). Females release small eggs (< 1 mm diameter) in nests exclusively built by males, which have been observed to reach the spawning grounds first (Ref. 5504, 12324, 51442). Spawning takes place mostly during sunny days, when water temperature is at least 15°C (Ref. 88171). Ammocoetes hatch after 7-14 days (41851, 88186). Successful hatching requires water temperatures of 15-25°C (Ref. 88715). Ammocoetes develop in freshwater and migrate to the sea after metamorphosis (Ref. 5504). Also Ref. 30578, 51442.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

There are four stages in the life cycle of sea lampreys, which usually spans 18 months but can last as long as 5 years. The first of these stages is the spawning phase, which occurs during spring and early summer. From April to June, sea lampreys search freshwater rivers and streams, seeking an ideal location in which to construct a nest and lay their eggs. Once the area is selected, male sea lampreys construct a nest, often moving rocks to create a large indenture or depression in the river or lake bed. A female then lays 30,000 to 100,000 eggs, which the male externally fertilizes. Both male and female adult sea lampreys float away and die soon after spawning. Unique to this phase is the disintegration of the digestive system; adult sea lampreys cannot feed while spawning. During the second phase, fertilized eggs settle into the sand or gravel and begin to grow. Within a few weeks, the eggs hatch and the larvae burrow further into the sand or gravel. Larvae filter-feed on algae and other aquatic organic matter. This larval phase can last for more than three years. In the third phase, known as transformation, larvae metamorphose into adult sea lampreys. During this phase sea lampreys develop a mouth, teeth and eyes. They also migrate to larger bodies of water, such as oceans or freshwater systems like the Great Lakes. Sea lampreys remain in this habitat for 12 to 18 months as a mature adult and begin to feed, attaching themselves to fish. This is known as the parasitic phase, during which sexual reproductive organs develop.

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Bence, J., . Bergstedt, G. Christie, P. Cochran, M. Ebener, J. Koonce, M. Rutter, W. Swink. 2003. Sea lamprey (Petromyzon marinus) parasite-host interactions in the Great Lakes. Journal of Great Lakes Research, 29/1: 253-282.
  • Bryan, M., D. Zalinski, K. Filcek, S. Libants, W. Li, K. Scribner. 2005. Patterns of invasion and colonization of the sea lamprey (Petromyzon marinus) in North America as revealed by. Molecular Ecology, 14/12: 3757–3773.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sea lampreys die soon after spawning. They can survive up to 5 years in the wild waiting for the opportune time to reproduce. Most lampreys, however, live 1.5 to 5 years in the wild.

Range lifespan

Status: wild:
1.5 to 5 years.

Typical lifespan

Status: wild:
1.5 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Little is known about the mating systems of sea lampreys. It is thought that male sea lampreys emit a pheromone composed of bile acids that alerts ovulating females to their presence. This signal may also be related to mating preferences and may be sent over large distances. Male sea lampreys selectively dig holes into river or stream bottoms and fertilize eggs once the female has laid them. This external fertilization allows multiple males to fertilize eggs.

Mating System: polygynous

From April to June, female sea lampreys lay between 30,000 and 100,000 eggs. These eggs are fertilized externally by males. Fertilized eggs hatch in 3 to 8 weeks. Larvae spend 1 to 3 years filter-feeding and do not associate with other sea lampreys. By 3 to 5 years of age, sea lampreys reach sexual maturity.

Breeding interval: Sea lampreys breed once at the end of their lifetime.

Breeding season: Sea lampreys breed between April and June.

Range number of offspring: 30,000 to 100,000.

Range gestation period: 3 to 8 weeks.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (External ); oviparous

Male sea lampreys selectively locate a nesting area. Sea lampreys do not allocate energy toward parental investment after laying and fertilizing eggs, as both male and female sea lampreys die shortly after spawning.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth

  • 2010. "Sea Lamprey Management Program" (On-line). U.S. Fish and Wildlife Service. Accessed September 24, 2010 at http://midwest.fws.gov/Marquette/index.html.
  • Great Lakes Fishery Commission. 2000. "The Great Lakes Fishery Commission" (On-line pdf). Sea lamprey. Accessed September 12, 2010 at http://www.seagrant.umn.edu/downloads/x106.pdf.
  • Bryan, M., D. Zalinski, K. Filcek, S. Libants, W. Li, K. Scribner. 2005. Patterns of invasion and colonization of the sea lamprey (Petromyzon marinus) in North America as revealed by. Molecular Ecology, 14/12: 3757–3773.
  • Lavis, D., A. Hallett, E. Koon, T. McAuley. 2003. History of and advances in barriers as an alternative method to suppress sea lampreys in the Great Lakes. Journal of Great Lakes Research, 29/1: 362-372.
  • Lavis, D., M. Henson, D. Johnson, E. Koon, D. Ollila. 2001. A case history of sea lamprey control in Lake Michigan: 1979 to 1999. Journal of Great Lakes Research, 29/1: 584-598.
  • Lesinski, J. 1996. Exotic Invaders: Killer Bees, Fire Ants, and Other Alien Species are Infesting America!. Chicago: Walker & Company.
  • Li, W., M. Siefkes, A. Scott, J. Teeter. 2003. Sex pheromone communication in the sea lamprey: Implications for integrated management. Journal of Great Lakes Research, 29/1: 85-94.
  • McLaughlin, R., A. Hallett, T. Pratt, L. O'Connor, D. McDonald. 2007. Research to guide use of barriers, traps, and fishways to control sea lamprey. Journal of Great Lakes Research, 33/2: 7-19.
  • Rohde, F., R. Arndt, D. Lindquist, J. Parnell. 1994. Freshwater Fishes of the Carolinas, Virginia, Maryland, and Delaware. Chapel Hill,North Carolina: The University of North Carolina Press.
  • Somervill, B. 2008. Sea Lamprey. New York: Cherry Lake Publishing.
  • Trautman, M. 1981. The Fishes Of Ohio. Ohio: Ohio State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs in spring (most areas) or summer. Late summer spawning was observed in Carp River, eastern Lake Superior (Noltie and Robilliard, 1987, Can. Field-Nat. 101:599-600). Eggs hatch in 10-12 days. Larvae leave nest after around three weeks. Larvae burrow in sand and silt bottom in quiet water downstream from spawning areas and filter-feed on plankton and detritus. Larval stage lasts up to several years. Larvae metamorphose in summer and fall, move to the ocean or a lake, feed on fish carrion and as parasites on other fishes for 20-30 months, return to streams to spawn, then die.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawn when the water temperature is about 10°C. Larvae are blind and toothless, with mouths and fins shaped differently than adults. Mature into adult form after 3 to 4 years.
  • Bigelow, H. B., and Schroeder. W.C.,1953; Hardisty, M.W., 1986, Billard, R., 1997.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Pheromone sends long-range signal: lamprey
 

Special glands in male sea lamprey gills help attract females from large distances by releasing a bile acid produced by the liver, which acts as a long-range sex pheromone.

   
  "During the reproductive season male lampreys. which build nests in streams, exude a substance that draws females from long distances downstream. A team of biologists headed by Weiming Li, of Michigan State University, has identified this substance- a bile acid produced by the liver and probably released through the gills by special glands found only in breeding males." (Reebs 2002:28)
  Learn more about this functional adaptation.
  • Reebs, Stephan. 2002. Samplings. Natural History. 111(7):
  • Li, W; Scott, A.P.; Siefkes, M.J.; Yan, H.; Liu, Q.; Yun, S.; Gage, D. 2002. Bile acid secreted by male sea lamprey that acts as a sex phermone. Science. 296: 138-141.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petromyzon marinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTCACATTCGTTGATTATTCTCTACTAATCACAAAGACATCGGCACCCTATATCTAATTTTCGGGGCCTGAGCAGGAATAGTAGGAACTGCTTTAAGTATTCTAATTCGAGCTGAACTAAGTCAGCCAGGCACTTTATTAGGAGACGACCAAATTTTTAATGTTATCGTAACTGCCCATGCCTTCGTCATAATCTTTTTTATAGTTATACCAATTATAATTGGAGGCTTTGGCAACTGACTTGTACCCCTAATACTTGGTGCTCCTGATATGGCCTTCCCTCGTATAAACAACATAAGTTTTTGACTACTTCCGCCCTCTTTACTTTTACTCTTAGCCTCTGCAGGAGTTGAAGCTGGGGCAGGAACAGGATGAACTGTATATCCTCCCTTAGCCGGAAACCTAGCCCACACCGGGGCCTCTGTCGACCTAACAATCTTTTCCTTACACTTAGCCGGAGTTTCATCAATTCTAGGAGCAGTTAATTTCATCACAACTATTTTTAACATGAAACCCCCAACTATGACTCAATACCAAACCCCCTTATTTGTTTGATCAGTCTTAATCACTGCAGTTCTTCTTCTTCTATCTCTACCAGTACTAGCAGCTGCTATCACAATACTTCTAACAGATCGTAACTTAAATACATCCTTCTTCGACCCTGCAGGAGGAGGAGACCCCATTCTTTACCAACACTTATTTTGATTCTTCGGACACCCTGAAGTTTATATTCTAATTCTTCCAGGCTTCGGAATTATTTCACACGTAGTTGCTTATTATGCTGGGAAAAAAGAACCATTCGGATATATAGGAATAGTTTGAGCAATAATAGCCATTGGACTACTAGGATTTATTGTTTGAGCTCATCACATATTTACAGTAGGAATAGACGTTGATACACGAGCCTATTTTACATCAGCCACAATAATTATTGCTATCCCAACAGGAGTCAAAGTCTTCAGTTGATTAGCCACTCTTCATGGAGGAAAAATCGTATGACATACCCCTATATTATGAGCCCTAGGTTTTATTTTCTTATTTACTGTAGGAGGACTCACAGGAATTGTTTTATCAAATTCATCACTAGACATTATTCTTCATGACACTTACTATGTTGTAGCCCATTTCCATTATGTTCTATCTATAGGAGCTGTTTTCGCAATTATAGCAGGATTTGTCCACTGATTCCCACTATTTACAGGATATACACTTAACGAAACCTGAGCAAAAGCTCATTTCATTATTATGTTTGCTGGTGTTAATCTTACATTCTTCCCTCAACACTTCCTAGGTCTAGCTGGAATACCACGACGTTACTCAGACTACCCAGATGCTTATACTACATGAAATATTATTTCCTCAATTGGGTCAACAGTCTCACTAATCGCTGTTATACTATTCATATTTATTTTATGAGAAGCTTTCTCTGCTAAACGTAAAGCTATTGCTACAGATCTTCTCAATACTAACCTTGAATGACTTCATGGCTGCCCACCTCCCTATCATACTTATGAAGAACCAGCCTTTGTTCAAACTAACTTCAAGAAAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Petromyzon marinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Justification
Generally rare, but widespread. Populations in central and western Europe, which had declined because of pollution problems, have been recovering since the 1980s.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sea lampreys are not protected. Indeed, as invasive species, efforts are in place to eradicate them from the Great Lakes region. Both federal and state governments have created programs to manage populations of and educate the community about this invasive, harmful species. Barriers and traps are set in the waterways to capture adult sea lampreys before they reproduce. Lampricides are also added to prime habitat of sea lampreys. These treatments specifically target lampreys and are designed not to harm other species. Each program has been tested for several years and has proven an effective control of sea lampreys.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed in Appendix III of the Bern Convention and Annex II of the EC Habitats Directive (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pollution and changes in land use have affected this species (2), and river construction works have prevented migration along many traditionally used rivers (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A number of UK sites that support sea lampreys have been designated as candidate Special Areas of Conservation (SACs). Although this will be a good foundation for conserving the species, further action will be required. To this end, a draft Action Plan has been produced to guide future conservation efforts (7). Furthermore the Life in UK Rivers Project is helping to conserve this species (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Because of their over-aggressive behavior and generalist diet, sea lampreys parasitize many species of fish, contributing to the severe decline of commercial fishing industries, including those on the Atlantic coast of North America and in the Great Lakes region. Each sea lamprey kills more than 18.2 kg of fish each year. This species has parasitized many species of native fish in the Great Lakes region since the early 1800s, leading to the collapse of the Great Lakes commercial fishing industry and costing it millions of dollars. Population declines of native fish in the region have also negatively impacted sport fishing and tourism. In one case, a sea lamprey bit a human, though this is thought to have been accidental.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sea lampreys are considered a delicacy in many foreign countries like Asia and India and are harvested for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sea lamprey

The sea lamprey (Petromyzon marinus) is a parasitic lamprey found on the Northern Atlantic Ocean of Europe and North America, in the western Mediterranean Sea, and in the Great Lakes. It is brown, gray, or black on its back and white or gray on the underside and can grow up to 90 cm (35.5 in) long. After several years in freshwater habitats, the larvae undergo a metamorphosis that allows young postmetamorphic lampreys to migrate to the sea or lakes and start the hematophagous feeding.[1] Some individuals can start the hematophagous feeding in the river before migrating to the sea,[2] where sea lampreys prey on a wide variety of fish.[3] The lamprey uses its suction cup-like mouth to attach itself to the skin of a fish and rasps away tissue with its sharp, probing tongue and keratinized teeth. Secretions in the lamprey's mouth prevent the victim's blood from clotting. Victims typically die from excessive blood loss or infection. After 1 year of hematophagous feeding, lampreys return to the river to spawn and die, one year and a half after the completion of metamorphosis.[4]

Contents

Invasion of the Great Lakes [edit]

Sea lamprey wounds on a Chinook salmon, Garden River First Nation.

Sea lampreys are considered a pest in the Great Lakes region. The species is native to the inland Finger Lakes and Lake Champlain in New York and Vermont. It is not clear whether it is native to Lake Ontario, where it was first noticed in the 1830s, or whether it was introduced through the Erie Canal which opened in 1825.[5] Improvements to the Welland Canal in 1919 are thought to have allowed its spread from Lake Ontario to Lake Erie, and while it was never abundant in either lake, it soon spread to Lake Michigan, Lake Huron, and Lake Superior, where it decimated indigenous fish populations in the 1930s and 1940s. They have created a problem with their aggressive parasitism on key predator species and game fish, such as lake trout, lake whitefish, chub, and lake herring. Elimination of these predators allowed the alewife, another invasive species, to explode in population, having adverse effects on many native fish species. The lake trout plays a vital role in the Lake Superior ecosystem. The lake trout is considered an apex predator, which means that they have no predators of their own. The sea lamprey is an aggressive predator by nature, which gives it a competitive advantage in a lake system where it has no predators and its prey lacks defenses against it. The sea lamprey played a large role in the destruction of the Lake Superior lake trout population. Lamprey introduction along with poor, unsustainable fishing practices caused the lake trout populations to decline drastically. The relationship between predators and prey in the Great Lakes' ecosystem then became unbalanced.

Efforts at control [edit]

Mouth of a sea lamprey, Petromyzon marinus

Control efforts, including electric current, chemical lampricides, and barriers, have met with varied success. The control programs are carried out under the Great Lakes Fishery Commission, a joint Canada–U.S. body, specifically by the agents of the Fisheries and Oceans Canada and the United States Fish and Wildlife Service.

Genetic researchers have begun mapping the sea lamprey's genome in the hope of finding out more about evolution; scientists trying to eliminate the Great Lakes problem are coordinating with these genetic scientists, hoping to find out more about its immune system and fitting it into its place in the phylogenetic tree. Several scientists in this field work directly for Fisheries and Oceans Canada or the United States Fish and Wildlife Service.

Researchers from Michigan State University have teamed up with others from the Universities of Minnesota, Guelph, and Wisconsin, as well as many others in a massive research effort into newly synthesized pheromones. These are believed to have independent influences on the sea lamprey behavior. One pheromone serves a migratory function in that odor emitted from larvae are thought to lure maturing adults into streams with suitable spawning habitat. A sex pheromone emitted from males is capable of luring females long distances to very specific locations. These two pheromones are actually both several different compounds thought to elicit different behaviors that collectively influence the lamprey to exhibit migratory or spawning behaviors. Effort is being made to characterize the function of each pheromone, each part of each pheromone, and if they can be used in a targeted effort at environmentally friendly lamprey control. Despite millions of dollars put into research, however, the most effective control measures are still being undertaken by control agents of state and federal agencies, but involve the somewhat publicly unacceptable application of TFM into rivers.

Another technique used in the prevention of lamprey population growth is the use of barriers in major reproduction streams of high value to the lamprey. The purpose of the barriers is to block their upstream migration to reduce reproduction. The issue with these barriers is that other aquatic species are also inhibited by this barrier. Fish that use tributaries are impeded from traveling upstream to spawn. To account for this, barriers have been altered and designed to allow the passage of most fish species but still impede others.

Genetics [edit]

The genome of Petromyzon marinus was sequenced in 2013.[6] This sequencing effort revealed that the lamprey has unusual GC content and amino acid usage patterns compared to other vertebrates.

The full sequence and annotation of the Lamprey genome is available on the Ensembl genome browser.

References [edit]

  1. ^ Silva, S., Servia, M. J., Vieira-Lanero, R. & Cobo, F. (2013a). “Downstream migration and hematophagous feeding of newly metamorphosed sea lampreys (Petromyzon marinus Linnaeus, 1758)”. Hydrobiologia 700: 277–286. Doi: 10.1007/s10750-012-1237-3
  2. ^ Silva, S., Servia, M. J., Vieira-Lanero, R., Nachón, D. J. & Cobo, F. (2013). Haematophagous feeding of newly metamorphosed European sea lampreys Petromyzon marinus on strictly freshwater species. Journal of Fish Biology. doi:10.1111/jfb.12100.
  3. ^ Beamish, F. W. H. (1980). “Biology of the North American anadromous sea lamprey, Petromyzon marinus”. Canadian Journal of Fisheries and Aquatic Sciences 37:1924−1943. doi: 10.1139/f80-233.
  4. ^ Silva, S., Servia, M.J., Vieira-Lanero, R., Barca, S. & Cobo, F. (2013b). Life cycle of the sea lamprey Petromyzon marinus: duration of and growth in the marine life stage. Aquatic Biology 18: 59–62. doi: 10.3354/ab00488.
  5. ^ Nonindigenous Aquatic Species Factsheet: Petromyzon marinus U.S. Geological Survey (USGS), Nonindigenous Aquatic Species Program (NAS). Retrieved on 2007-08-04.
  6. ^ Smith, Jeramiah J; Kuraku, Shigehiro; Holt, Carson; Sauka-Spengler, Tatjana; Jiang, Ning; Campbell, Michael S; Yandell, Mark D; Manousaki, Tereza; Meyer, Axel; Bloom, Ona E; Morgan, Jennifer R; Buxbaum, Joseph D; Sachidanandam, Ravi; Sims, Carrie; Garruss, Alexander S; Cook, Malcolm; Krumlauf, Robb; Wiedemann, Leanne M; Sower, Stacia A; Decatur, Wayne A; Hall, Jeffrey A; Amemiya, Chris T; Saha, Nil R; Buckley, Katherine M; Rast, Jonathan P; Das, Sabyasachi; Hirano, Masayuki; McCurley, Nathanael; Guo, Peng; Rohner, Nicolas; Tabin, Clifford J; Piccinelli, Paul; Elgar, Greg; Ruffier, Magali; Aken, Bronwen L; Searle, Stephen M J; Muffato, Matthieu; Pignatelli, Miguel; Herrero, Javier; Jones, Matthew; Brown, C Titus; Chung-Davidson, Yu-Wen; Nanlohy, Kaben G; Libants, Scot V; Yeh, Chu-Yin; McCauley, David W; Langeland, James A; Pancer, Zeev; Fritzsch, Bernd; de Jong, Pieter J; Zhu, Baoli; Fulton, Lucinda L; Theising, Brenda; Flicek, Paul; Bronner, Marianne E; Warren, Wesley C; Clifton, Sandra W; Wilson, Richard K; Li, Weiming (2013). "Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution". Nature Genetics. doi:10.1038/ng.2568. ISSN 1061-4036. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!