Overview

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (<100 square km (less than about 40 square miles)) This species is endemic to Unthanks Cave and caves surrounding, Lee Co., Virginia (Hershler, 1989). The species has been collected in at least four other caves scattered about southwest Virginia, with an enigmatic population documented from Skyline Caverns as well, perhaps 300 miles north down the Shenandoah Valley that is currently undescribed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Holsingeria unthanksensis Hershler, 1989
Catalog Number: USNM 860421
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): R. Hershler, J. Holsinger, P. Greenhall & R. Phillips
Year Collected: 1986
Locality: Unthanks Cave Stream, 11.0 Km SW Of Jonesville, Lee County, Virginia, United States
  • Holotype: Hershler, R. 1989. Malaccological Review. 22: 93-100.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Holsingeria unthanksensis Hershler, 1989
Catalog Number: USNM 860422
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry; Alcohol (Ethanol)
Collector(s): J. Holsinger
Year Collected: 1980
Locality: Unthanks Cave Stream, 11.0 Km SW Of Jonesville, Lee County, Virginia, United States
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: This species is endemic to Unthanks Cave and caves surrounding, Lee Co., Virginia (Hershler, 1989). The species has been collected in at least four other caves scattered about southwest Virginia, including Tater, Burial, Jones Saltpetre and Gibson No. 1 Caves in Lee Co., Virginia (VA NHP, pers. comm., 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holsingeria unthanksensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTTGGGAACGCCCTTAGCTTACTAATCCGAGCCGAACTAGGTCAACCCGGAACCCTTTTAGGAGAC---GACCAATTATACAACGTAATCGTCACTGCTCATGCTTTCGTTATAATTTTCTTTCTAGTTATGCCTATAATAATTGGTGGTTTCGGAAATTGATTAGTACCACTCATGCTAGGAGCCCCCGACATAGCGTTTCCTCGCCTGAATAACATAAGTTTCTGATTATTACCGCCTGCCCTTACACTACTGCTATCTTCAGCTGCTGTAGAAAGGGGCGCCGGAACAGGATGAACAGTCTACCCACCACTAGCTAGCAACTTGGCTCACGCGGGCGGATCTGTAGACTTAGCCATCTTTTCTTTACATCTAGCAGGAGCTTCCTCCATTCTAGGAGCTGTAAACTTCATTACCACCATTATCAACATACGATGACGAGGAATACAACTTGAACGACTTCCATTATTCGTCTGATCTGTAAAAATTACAGCCATCTTGCTCTTGCTATCACTTCCCGTGCTAGCCGGAGCCATTACAATACTCTTAACTGATCGAAATTTTAATACAGCCTTCTTCGAACCTGCTGGAGGGGGTGACCCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Holsingeria unthanksensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Endemic to Unthanks Cave and four caves surrounding, in Lee Co., Virginia.

Intrinsic Vulnerability: Highly vulnerable

Environmental Specificity: Very narrow. Specialist or community with key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Unthanks Cave, with about 7.3 miles of mapped passages, was purchased by The Nature Conservancy several years ago and has recently been deeded over to the Commonwealth of Virginia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!