Overview

Comprehensive Description

Biology

Usually occurs on exposed coast, on sand or hard mud bottom below low tide, rarer in bays. Usually found inside objects, especially mollusk shells, clam burrows and bottles. Demersal spawners in nearshore habitats (Ref. 56049). Female deposits eggs in clam burrows or under rocks, male guards them.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sarcastic fringeheads can be found along the Pacific Coast from San Francisco, California to central Baja California, Mexico (Eschmeyer 1983).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: San Francisco in California, USA to central Baja California, Mexico.
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Sarcastic fringeheads are the largest of all fringeheads (Eschmeyer 1983). They can grow to be 30.0 cm in length (Williams 2000). They possess the clinid family characteristics of a long dorsal fin, as well as wavy, fringe-like cirri on their heads ("PBS: Sea Dwellers" 2000). They are specifically known for their extremely large mouths. This is due, in part, to their characteristically long maxillary that extends nearly to the back edge of the gill cover (Gotshall 1989).

The bodies of the sarcastic fringeheads are long, slender and compressed. They possess unbranched pectoral fin rays (CALCOFI 1996). In addition, the dorsal fins extend continuously from the head to the base of the tail fin. Further, the anal fin extends from vent to the base of the tail fin (Barnhart 1936).

Fringeheads are generally brownish-gray and typically mottled with either red or green patches ("A Learning Link to the Aquarium of the Pacific" 2000). The dorsal spines possess two ocelli, one between the first and second spines, and the other between the fifth and ninth spines (Gotshall 1989). These ocelli are generally blue and outlined by a yellow ring ("A Learning Link to the Aquarium of the Pacific" 2000).

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 6 years (Ref. 43439)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • Love, R.M. 1991 Probably more than you want to know about the fishes of the Pacific coast. Really Big Press, Santa Barbara, California, USA, 215 p. (Ref. 43439)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Neoclinus blanchardi
Catalog Number: USNM 691
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Blanchard
Year Collected: 1849
Locality: Coast of Cala., Off San Diego., California, United States, Pacific
  • Type: 1858. Reports of explorations and surveys, to ascertain the most practicable and economical route for a railroad from the Mississippi River to the Pacific Ocean. 10: 114.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sarcastic fringeheads are found in a demersal, marine environment (Williams 2000). They occupy depths ranging from three to sixty-one meters. (Gotshall 1989). Fringeheads can be found in a subtropical climate typically around 38* C (Williams 2000).

 More specifically, sarcastic fringeheads can be found along the exposed coast of the Pacific Ocean. At times, they can be seen on the sand or the mud bottom below low tide (Williams 2000) Typically, they occupy empty shells, abandoned holes and crevices ("PBS: Sea Dwellers" 2000). In some areas they even take up residence in old cans and bottles. In fact, in the "beer bottle field" of Santa Monica Bay, nearly every bottle is a home to a fringehead ("A Learning Link to the Aquarium of the Pacific" 2000).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 3 - 73 m (Ref. 43439)
  • Love, R.M. 1991 Probably more than you want to know about the fishes of the Pacific coast. Really Big Press, Santa Barbara, California, USA, 215 p. (Ref. 43439)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 61m.
From 3 to 61 meters.

Habitat: demersal. Usually occurs on exposed coast, on sand or hard mud bottom below low tide, rarer in bays. Usually found inside objects, especially mollusk shells, clam burrows and bottles. Female deposits eggs in clam burrows or under rocks, male guards them.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Sarcastic fringeheads are omnivores. They consume roughly 13.6 times their body weight per year (Williams 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Females lay eggs in abandoned boring clam holes, under rocks, in beer containers, and other containers. Males guard the eggs until they hatch (Ref. 43439).
  • Love, R.M. 1991 Probably more than you want to know about the fishes of the Pacific coast. Really Big Press, Santa Barbara, California, USA, 215 p. (Ref. 43439)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sarcastic fringeheads generally spawn from January to August. They are oviparous creatures. The female lays her eggs in what is usually an abandoned burrow. It is then the task of the male to guard the nest that is attached to the wall of the shelter (CALCOFI 1996).

 The eggs are typically 0.9 to 1.5 mm in diameter. Each egg has an oil globule component as well as filaments by which they are attached both to the nest itself as well as to the other eggs (CALCOFI 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neoclinus blanchardi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATCTTTGGTGCCTGGGCCGGCATGGTCGGGACTGCCCTCAGTCTCTTAATCCGAGCCGAACTCAGCCAACCCGGGGCTCTTCTCGGGGACGATCAGATTTATAACGTTATCGTAACCGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCTATTTTGATTGGAGGGTTCGGCAACTGACTAATCCCCCTAATGATCGGGGCCCCTGATATGGCATTCCCACGCATGAACAACATGAGCTTCTGACTCCTACCCCCTTCCTTCCTCCTTCTTTTAGCCTCCTCTGGCGTAGAAGCAGGGGCTGGAACAGGATGAACTGTTTACCCCCCTCTATCTGGCAACCTCGCCCACGCCGGAGCCTCCGTCGACTTAACAATTTTCTCACTTCACCTAGCAGGGGTTTCCTCTATTTTAGGCGCAATCAATTTTATTACTACCATTATTAACATAAAACCTCCCGCTGTCTCACAGTACCAAACACCTTTATTTGTGTGATCCGTTTTAATTACAGCCGTCCTTCTTCTCCTCTCTCTTCCTGTACTCGCTGCGGGCATCACAATGCTCCTAACGGACCGAAATCTTAACACAACTTTCTTTGACCCTGCTGGAGGAGGAGACCCCATCCTTTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neoclinus blanchardi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

With the exception of attacking humans that intrude into their space, sarcastic fringeheads are considered harmless (Williams 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sarcastic fringehead

The Sarcastic fringehead, Neoclinus blanchardi, is a small but ferocious fish which has a large mouth and aggressive territorial behavior, for which it has been given its common name.[1] When two fringeheads have a territorial battle, they wrestle by pressing their distended mouths against each other, as if they were kissing. This allows them to determine which is the larger fish, which establishes dominance.[2]

They can be up to 30 centimetres (12 in) long,[3] elongate and slender,[1] and are mostly scaleless with great pectoral fins and reduced pelvic fins. They tend to hide inside shells or crevices. After the female spawns under a rock or in clam burrows the male guards the eggs.

They are found in the Pacific, off the coast of North America, from San Francisco, California, to central Baja California. Their depth range is from 3 to 73 metres (9.8 to 239.5 ft).[3]

Sarcastic fringehead in plastic tube.JPG

References[edit]

  1. ^ a b http://www.aquariumofpacific.org/onlinelearningcenter/species/sarcastic_fringehead
  2. ^ Denny, Mark; Steven Gaines (2002). Chance in Biology. Princeton: Princeton University Press. p. 13. ISBN 0691094942. 
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Neoclinus blanchardi" in FishBase. February 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!