Overview

Comprehensive Description

Biology/Natural History: Mussels such as these attach by byssal threads and are often found in clusters. In the photo above the byssal threads secreted by this mussel can be seen on the ventral (lower) side, and several other byssal threads by which other mussels had attached to this one are visible on the side and the dorsal surface of the shell. Besides looking almost identical (they can be distinguished mainly by molecular means), the ecological requirements of this species seem to be very similar to that of Mytilus galloprovincialis, the Mediterranean or southern bay mussel, except for a few differences. Presumably M. trossulus favors cooler water, and my observation has been that M. trossulus is less tolerant of the strong wave action of the open coast than is M. galloprovincialis. Both these species are said to occur in mixed populations with M. californianus on the open coast, and I have observed this in S. California. However, it appears to me that very few M. trossulus grow on exposed sites on the open coast. I believe that the small, smoother mussels seen on the open coast of Washington along with the larger M. californianus are almost always simply young M. californianus rather than M. trossulus. I base this conclusion on the observation that M. californianus are usually more elongated with a more pointed umbo than is M. trossulus. This conclusion needs to be tested by more definitive means, such as by molecular analysis.

Bay mussels filter feed almost continuously, mainly on detritus particles but also on plankton down to 4-5 microns. Detrital particles sloughed off kelps such as Laminaria and Agarum seem to lead to the highest growth rates. They capture food on mucus sheets on the gills, but can sort and reject some particles. They can likely also absorb dissolved organic materials directly from the water. During blooms of the dinoflagellate Alexandrium catanella, which blooms at sea temperatures exceeding 13C, this species may accumulate toxic levels of the paralytic shellfish poisoning (PSP) toxin. Unlike the butter clam Saxidomus gigantea which also accumulates the toxin, after the bloom is finished this species rapidly purges its tissues of the toxin. Therefore it is one of the indicator species used to test for the presence of PSP. Pumping rate is up to 2.5 liters/h per gram of body weight. Predators include seastars such as Pisaster ochraceous, Leptasterias hexactis, and Pycnopodia helianthoides, anemones such as Urticina crassicornis and Anthopleura xanthogrammica, oyster drills such as the frilled dogwinkle Nucella lamellosa, large crabs, diving ducks, pile perch, shiner perch, surf scoters, black oystercatchers, Barrow's goldeneyes, gulls, crows, sea otters, and mink. It sometimes defends itself against oyster drill whelks by gluing a byssal thread to the whelk and to a nearby rock, thus tethering the snail to the rock until it starves. Byssal thread formation is inhibited by mercury and copper so this species does not live where these pollutants occur. The gut may contain the parasitic copepod Mytilicola orientalis. In Puget Sound they spawn in April and May. Larvae are planktonic veligers for 4-7 weeks. They settle into areas with filamentous algae, byssal threads, hydroids, Semibalanus cariosus, or bare rock. Adults live 2-3 years in California, probably longer farther north.

This species is probably referred to as the foolish mussel because of the large clusters which sometimes formed, attached weakly to one another by byssal threads. The cluster can become so large and the attachment to the rock so weak that the entire cluster breaks off and washes away, often into the waiting mouths of predators.

Note: Most references to bay mussels before 1990 refer to M. edulis. However, it has not been concluded from molecular analysis that M. edulis does not occur on our Pacific coast. Past references to M. edulis should usually be taken to refer to M. galloprovincialis if the location is south of San Francisco, and to M. trossulus if well north of San Francisco. The two species appear to by hybridizing just north of San Francisco, and M. galloprovincialis is extending its range northward. M. galloprovincialis is being commercially cultivated in Puget Sound, and a population of M. edulis has been introduced to Georgia Strait so further hybridization will likely occur. Elliott et al. (2008) report that by the time of their study, M. galloprovincialis and hybrids between M. galloprovincialis and M. trossulus occurred throughout the Puget Sound and Rosario area. Compared to M. trossulus, M. galloprovincialis and hybrids between the two were more common on docks rather than intertidally, and if intertidal were more common lower in the intertidal than was M. trossulus. The two species appeared to be mating randomly with one another.

M. trossulus is now known to also occur in several populations in northern Europe, including Norway and Russia (Väinölä and Strelkov, 2011).

On the open coast this species is more susceptible to predation by the snails Nucella emarginata and N. canaliculata than is the larger Mytilus californianus (Wootton, 2002)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This mussel has a relatively smooth shell with smooth growth lines, little erosion, and no major radiating ridges. The periostracum is a smooth, shiny black (or sometimes brown--photo) and without hairs. The shell is longer than high and the umbones are at the pointed anterior end. Length usually less than 7 cm; up to 11 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Maine, North West Atlantic, Swedish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: Eastern Bradelle Valley), lower St. Lawrence estuary; Cobscook Bay; south to Little Machias Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: North of San Francisco to Arctic Ocean (Historically the range extended much farther south to Baja California. Southern end of range is probably contracting due to competition with the mediterranean mussel Mytilus galloprovincialis--see more below on this). Populations of very similar mussels are also found in Japan and Australia, but I do not know whether these are of this species or of one of the very similar-appearing species. Likely also on the Russian Pacific coast. Some populations occur in the North Atlantic.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Mytilus californianus is similarly shaped but is usually even more elongated, has coarse radiating ribs, often has an eroded surface, grows much larger, and is most common on the outer coast. Horse mussels such as Modiolus modiolus usually have dark brown , hairy periostracum. This species is very difficult to distinguish morphologically from M. galloprovincialis, which is found from San Francisco south, and from M. edulis, which is found in the Atlantic Ocean.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

intertidal and infralittoral of Gulf and estuary; common in rocky intertidal to 40 m, also found on docks, pilings, floats, and gravel
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): -14 - 27
  Temperature range (°C): 7.165 - 10.151
  Nitrate (umol/L): 2.084 - 6.725
  Salinity (PPS): 6.151 - 31.893
  Oxygen (ml/l): 6.561 - 8.227
  Phosphate (umol/l): 0.286 - 1.030
  Silicate (umol/l): 9.489 - 20.289

Graphical representation

Depth range (m): -14 - 27

Temperature range (°C): 7.165 - 10.151

Nitrate (umol/L): 2.084 - 6.725

Salinity (PPS): 6.151 - 31.893

Oxygen (ml/l): 6.561 - 8.227

Phosphate (umol/l): 0.286 - 1.030

Silicate (umol/l): 9.489 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Intertidal to 40 m; wharves, docks, pilings

Habitat: Mostly quiet bays. Said to be found also on open coast in mixed populations with M. californianus.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mytilus trossulus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 170 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAAAAAAAATATAAAAAAATCTCTTAAAAAGCCTTTATCTATACAAAAAGGGTCGTCAGAAATTAAATTTTTGCCAAAGATAGCTGAAACAAAAGTTGTTGAAGTGGAGTCATGGTGGCGTCGGTGGTTGTGATCAACGAACCATAAGGACATTGGTACTCTTTACTTGTACAGAGGAGTCTGAGGCGGTCTATTTGGAGCAAGGCTAAGTCTAATGATCCGTATGCAATTAGGGCATCCTGGGGCAGTGTTTTTAAAAAGAGATTGGTTTTTCAATGTAGTGGTTACAACCCATGCATTAATGATAATTTTCTTTGCTGTAATGCCTATTTTAATTGGGGCCTTCGGAAATTGACTTATTCCTCTACTGGTAGGAGGTAAAGATATAATTTACCCTCGGATAAACAATTTAAGGTATTGACTGTCGCCTAACGCGTTATATTTGCTTATGCTATCTTTTATAACAGACAAAGGAGTGGGTGCGGGATGGACCCTTTACCCTCCTTTATCTAGATACCCTTATCATAGAGGTCCAAGCATAGATGTTATGATTGTGGCGCTACATTTGGCAGGGGCTAGCTCTTTAGTAGGGGCTATTAATTTTGCTAGTACTAATAAAAATATACCAGCTTTGGAGATAAAAGGGGAGCGAGCTGAGCTTTACGTATTAAGAATCAGAGTTACTGCAGTTCTTTTAATTATCTCCATTCCGGTCTTAGGAGGTGGGGTCACAATAATTCTTTTTGACCGAAACTTTAACACGACATTTTTTGACCCGGCAGGCGGAGGAGACCCGGTTCTGTTCCAACATTTGTTCTGGTTTTTTGGGCACCCTGAAGTGTACATTCTTATCCTTCCAGCTTTTGGGGTAATATCAAAAGTGATTATGCATTGTTCTGGAAAAGAAGCAGTTTTCGGGCTAATCGGGATAGTGTACGCTATAATTGGGATTGGAGGGCTGGGCTGTATAGTGTGGGCCCACCATATGTTTACGGTAGGCCTTAATGTGGATACTCGAGGCTATTTCTCCACTGCAACCATAGTAATCGCGGTTCCTACAGGAGTAAAAGTGTTTAGGTGATTAGCAACTATAGCGGGAAGAAAATTTAAAATAAAGCCTGCTGCCTATTGAAGTACTGGGTTTCTGTTTTTGTTTACCGTAGGAGGGCTAACTGGGGTGTTGCTATCTAGAGCTTCTATAGACGTTTCTTTACATGATACCTATTACGTGGTTGCCCATTTCCACTACGTTTTAAGTATAGGAGCAGTGTTTGGAGTGTTCTGTGGGCTTAATCATTGGATGCCAAATTTTGTTGGAGTTTGCTTGAATAAGAAATGAAGAAAATCTCATTTTATAGCCATATTTTTCGGAGTAAATACTACTTTTTTCCCTCAGCATTTCTTAGGTTTAAGAGGTATGCCCCGACGTTATATAGACTATGCTGATATCTACTCTCACTGACATTGGGTGTCTACTTACGGGTCTGCCGTGTCTTTCGGGTCCCTTATGTATTTTAAATTTCTCTTTTGAGAAGCTGTAGTAAGCCAACGGGGAGTGGTCTTCAGAGGTGGTTTGTGAGGTGAAATAGATTGAGGGGGAACTCGCGACCTCTACCCAGGTAGAAAGCATGTGTATAGTCAACTCCCTTACGTATGAACAAACCCCTATAATACAAGGATTACTTATATCTATAAAAAGCTACGTAATCAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mytilus trossulus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 169
Specimens with Barcodes: 202
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mytilus trossulus

Mytilus trossulus, the bay mussel or foolish mussel, is a medium-sized edible marine bivalve mollusc in the family Mytilidae.

Mytilus trossulus is one of the three principal, closely related taxa in the Mytilus edulis complex of blue mussels, which collectively are widely distributed on the temperate to subarctic coasts the Northern Hemisphere, and often are dominant inhabitants on hard substrates of the intertidal and nearshore habitats.

Distribution

Mytilus trossulus is the main native intertidal mussel in the Northern Pacific. In North America it is found from California to Alaska, and in Asia from Hokkaido northwards. At its southern limits, it hybridizes with Mytilus galloprovincialis (the Mediterranean mussel), which has been introduced to the Pacific by human activity.[1]

In the North Atlantic, M. trossulus is found on the U.S. coast of Maine and northwards to Canada,[1] as well as in scattered localities on North European coasts.[2] In these regions it often coexists and hybridizes with Mytilus edulis. The entire Baltic Sea is inhabited by a peculiar population of Mytilus trossulus, which shows some genetic introgression from M. edulis and whose mitochondrial DNA has been replaced by M. edulis mtDNA.[2]

Trivia

The species is the subject of long-term environmental monitoring in Prince William Sound, Alaska, to examine hydrocarbon signatures in order to develop a better understanding of the ecosystem's ongoing recovery from the Exxon Valdez oil spill which occurred there.[3]

References

  1. ^ a b McDonald JH, Seed R, Koehn RK (1991) Allozyme and morphometric characters of three species of Mytilus in the northern and southern hemispheres. Marine Biology 111:323–335.
  2. ^ a b Vainola R, Strelkov P (2011) Mytilus trossulus in Northern Europe Marine Biology 158: 817-833.
  3. ^ Payne, J.; Driskell, W.; Short, J.; Larsen, M. (2008). "Long term monitoring for oil in the Exxon Valdez spill region". Marine pollution bulletin 56 (12): 2067–2081. doi:10.1016/j.marpolbul.2008.07.014. PMID 18835610.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!