Overview

Comprehensive Description

Biology

Elysia cf. marginata sp.3", nick-named "dark pigment", is one of 4 cryptic species in the Elysia marginata complex recently documented from the Indo-Pacific using a combination of molecular, morphological, and developmental characters. Found on the green algal genus Bryopsis, the species in this complex are sometimes termed "E. ornata", which is a distinct Caribbean species, or "E. grandifolia", an Indo-Pacific taxon with no definitive characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Elysia cf. marginata sp.3": Overall darker coloration than other members of the marginata-grandifolia complex. Parapodial edges ruffled, with three successive colored bands: (1) continuous, thick, black marginal band; (2) bright white submarginal band; (3) dull orange-red submarginal band, farthest from the edge. Sides of parapodia dotted by brown-black spots of uneven size, with white patches forming zig-zags along body. Squared-off tail with orange and black marginal bands running along edge. Rhinophores white-tipped with distal orange band and white streaks along distal half. Renopericardium longer and more elongate than in other marginata complex members; white with black spots.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Elysia cf. marginata sp. 4", nick-named "white lines", is one of 4 cryptic species in the Elysia marginata complex recently documented from the Indo-Pacific using a combination of molecular, morphological, and developmental characters. Found on the green algal genus Bryopsis, species in this complex are sometimes termed "E. ornata", which is a distinct Caribbean species, or "E. grandifolia", an Indo-Pacific taxon with no definitive characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Elysia cf. marginata sp. 4": Parapodial edges smooth, with three successive colored bands: (1) black marginal band; (2) orange submarginal band; (3) very thick, white submarginal band, farthest from the edge. Sides of parapodia dotted by large black spots and larger white patches. Tail tapering to end of body but not pointed or elongated. Proximal two-thirds of rhinophores red, distal third black; white spot on head extending up each rhinophore. Rounded pericardium tapers to a point; white with black spots.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Elysia cf. marginata sp.2", nick-named "red tips", is one of 4 cryptic species in the Elysia marginata complex recently documented from the Indo-Pacific using a combination of molecular, morphological, and developmental characters. Found on the green algal genus Bryopsis, the species in this complex are sometimes termed "E. ornata", which is a distinct Caribbean species, or "E. grandifolia", an Indo-Pacific taxon with no definitive characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Elysia cf. marginata sp.2”: Parapodia with black marginal band and red submarginal band; edges may form one siphonal opening. Body covered with tiny discrete black and white spots. Pointed, elongated tail with red submarginal band running to tip. Proximal half of rhinophores white, distal half red-orange, with white spot at tip. Rounded pericardium, solid white, no spots. Four pairs of branching vessels exit renopericardium, longest pair running posteriorly towards tail with anasthomosing side branches. Egg masses contain regularly spaced blobs of bright yellow extra-capsular yolk; planktotrophic development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Elysia cf. marginata sp.1", nick-named "3 siphons", is one of 4 cryptic species in the Elysia marginata complex recently documented from the Indo-Pacific using a combination of molecular, morphological, and developmental characters. Found on the green algal genus Bryopsis, the species in this complex are sometimes termed "E. ornata", which is a distinct Caribbean species, or "E. grandifolia", an Indo-Pacific taxon with no definitive characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Elysia cf. marginata sp. 1": Parapodia may be high or low; undulating edges form 3 wide siphonal openings. Siphons lined with orange edges but otherwise there no continuous marginal or submarginal band of color. Body covered with regularly spaced white spots and scattered black spots, dense along parapodial margin. Rhinophores with black spots on green background, white tips. No extended tail; body squared off posteriorly. Oval pericardium, posterior half white with black spots; 3-4 pairs of wide, bifurcating and anasthomosing dorsal vessels. Egg masses contain a continuous string of black extra-capsular yolk fading into grey-white streaks; planktotrophic development.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Japan, Australia, Moorea, Palmyra Atoll

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

known only from Japan

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

known from Japan, Vanuatu, Guam, and Hawaii

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

known from Guam and Moorea, French Polynesia

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 217 specimens in 33 taxa.
Water temperature and chemistry ranges based on 149 samples.

Environmental ranges
  Depth range (m): 0 - 17.8
  Temperature range (°C): 11.646 - 29.212
  Nitrate (umol/L): 0.033 - 6.151
  Salinity (PPS): 33.594 - 36.130
  Oxygen (ml/l): 4.346 - 6.213
  Phosphate (umol/l): 0.074 - 0.425
  Silicate (umol/l): 1.110 - 5.231

Graphical representation

Depth range (m): 0 - 17.8

Temperature range (°C): 11.646 - 29.212

Nitrate (umol/L): 0.033 - 6.151

Salinity (PPS): 33.594 - 36.130

Oxygen (ml/l): 4.346 - 6.213

Phosphate (umol/l): 0.074 - 0.425

Silicate (umol/l): 1.110 - 5.231
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 16

Graphical representation

Depth range (m): 1 - 16
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

green algae in the genus Bryopsis

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

One of 4 cryptic species in the Elysia marginata complex, all found on Bryopsis spp. Intra-specific mtDNA clades can be up to 6% divergent at the COI barcoding locus in this complex, whereas morphologically and developmentally distinct species are >8% divergent (Krug. et al., in press).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Elysia sp. 1 KH-2007

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATTTAATTTTTGGAATATGGTGTGGTCTCGTGGGAACCGGATTA---AGTTTGTTAATTCGATTTGAGTTAGGGACTTCTGGTGCCTTTTTGGGGGAT---GATCATTTTTATAATGTAATTGTAACAGCTCACGCTTTTGTGATAATTTTTTTTATAGTAATACCTTTAATAATTGGTGGGTTTGGAAATTGAATAGTGCCAATTTTA---ATTGGTGCTCCTGATATAAGTTTCCCACGAATGAATAATATAAGTTTTTGATTGCTACCTCCATCTTTCGTTTTTCTCCTGTCTTCAAGTCTTGTAGAAGGAGGTGCCGGAACTGGATGAACTGTGTACCCTCCGCTAAGGGGACCTATTGGTCATGGAGGTGCGTCAGTGGACTTG---GCAATTTTCTCGCTTCATCTAGCAGGGATATCATCTATTCTGGGTGCAGTAAACTTTATTACCACTATTTTTAATATACGTTCTCCAGGTATAACCATGGAACGTTTAAGCTTGTTTGTTTGATCTGTTTTAGTTACTGCTTTTTTATTACTTTTATCATTGCCAGTACTAGCAGGG---GCAATTACAATACTCTTAACAGATCGAAATTTTAATACAAGTTTCTTTGATCCGGCTGGTGGTGGTGATCCTATTTTGTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elysia sp. 1 KH-2007

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Elysia sp. 5 KH-2007

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATACTTAATTTTTGGTATATGGTGTGGTTTAGTAGGTACTGGCTTA---AGTTTACTAATTCGATTTGAACTAGGGACTTCTGGTGCTTTTTTAGGGGAC---GATCACTTTTATAATGTAATTGTTACTGCTCATGCCTTTGTTATAATTTTTTTTATAGTAATACCCTTAATAATTGGTGGATTTGGAAATTGAATAGTGCCTATTTTA---ATTGGTGCTCCAGATATAAGTTTTCCGCGTATAAATAATATAAGATTTTGATTACTCCCACCTTCTTTCATTTTTCTCCTGTCTTCAAGTCTCGTAGAAGGAGGTGCGGGAACTGGATGAACTGTGTACCCACCACTGAGGGGACCTATTGGTCACGGAGGTGCGTCAGTAGACTTG---GCAATTTTCTCGCTGCATCTAGCGGGGATATCATCTATTCTGGGTGCGGTAAACTTTATTACCACTATTTTTAACATACGTTCTCCTGGTATAACTATAGAACGTTTAAGTTTGTTTGTTTGATCTGTATTAGTAACTGCATTTCTATTACTTTTATCTTTACCTGTACTAGCTGGT---GCAATTACAATGTTACTAACTGATCGTAATTTTAATACTAGATTTTTTGATCCCGCAGGAGGAGGGGATCCAATTTTATACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elysia sp. 5 KH-2007

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Elysia sp. ALB-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTGCTTTTTTAGGAGAT---GATCATTTTTATAACGTAATTGTTACAGCACATGCCTTCGTTATAATTTTTTTTATAGTTATACCTTTAATAATCGGTGGATTTGGTAATTGAATGGTTCCAATTTTAATTGGAGCTCCAGACATAAGTTTCCCACGAATAAATAATATGAGATTTTGATTACTTCCTCCTTCTTTTGTATTTCTTCTGTCCTCAAGTCTTGTAGAAGGAGGTGCTGGAACAGGATGAACTGTGTACCCTCCACTAAGGGGTCCTATTGGTCATGGAGGTGCGTCAGTAGACTTGGCTATTTTTTCACTGCATTTAGCAGGGATGTCATCTATTCTAGGTGCAGTAAACTTTATTACTACTATTTTTAATATGCGATCTCCAGGTATAAGTATAGAACGTTTAAGTTTATTTGTTTGATCGGTTCTAGTAACTGCCTTCCTTTTACTTTTATCTTTACCTGTACTAGCGGGAGCTATTACTATGTTATTAACAGACCGTAATTTTAATACAAGTTTTTTTGATCCTGCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elysia sp. ALB-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:89Public Records:72
Specimens with Sequences:77Public Species:22
Specimens with Barcodes:73Public BINs:29
Species:26         
Species With Barcodes:22         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Elysia

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

References

Krug, P.J., Vendetti, J.E., Retana, J., Rodriguez, A., Hirano, Y., and Trowbridge, C.D. 2013. DNA barcoding of mitochondrial and nuclear loci reveals rampant cryptic speciation among sea slugs studied for drug discovery, plastid symbiosis and biological control. Molecular Phylogenetics and Evolution, in press.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Members of the Elysia marginata complex and the related species E. rufescens are sources of anti-cancer compounds called kahalalides, depsipeptides derived from the algal diet of the slug; unrecognized cryptic species in this complex introduce confusion into drug discovery work by obscuring the source of new kahalalides. Clarifying taxonomic uncertainty is thus important for natural products chemistry and bioprospecting for novel chemotherapeutic agents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

References

Krug, P.J., Vendetti, J.E., Retana, J., Rodriguez, A., Hirano, Y., and Trowbridge, C.D. 2013. DNA barcoding of mitochondrial and nuclear loci reveals rampant cryptic speciation among sea slugs studied for drug discovery, plastid symbiosis and biological control. Molecular Phylogenetics and Evolution, in press.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Members of the Elysia marginata complex and the related species E. rufescens are sources of anti-cancer compounds called kahalalides, depsipeptides derived from the algal diet of the slug; unrecognized cryptic species in this complex introduce confusion into drug discovery work by obscuring the source of new kahalalides. Clarifying taxonomic uncertainty is thus important for natural products chemistry and bioprospecting for novel chemotherapeutic agents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

References

Krug, P.J., Vendetti, J.E., Retana, J., Rodriguez, A., Hirano, Y., and Trowbridge, C.D. 2013. DNA barcoding of mitochondrial and nuclear loci reveals rampant cryptic speciation among sea slugs studied for drug discovery, plastid symbiosis and biological control. Molecular Phylogenetics and Evolution, in press.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Members of the Elysia marginata complex and the related species E. rufescens are sources of anti-cancer compounds called kahalalides, depsipeptides derived from the algal diet of the slug; unrecognized cryptic species in this complex introduce confusion into drug discovery work by obscuring the source of new kahalalides. Clarifying taxonomic uncertainty is thus important for natural products chemistry and bioprospecting for novel chemotherapeutic agents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Krug, Patrick

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Elysia (gastropod)

Elysia is a genus of sea slugs, marine gastropod molluscs in the family Plakobranchidae. These animals are colorful sea slugs, and they can superficially resemble nudibranchs, but are not very closely related to them. Instead they are sacoglossans, commonly known as sap-sucking slugs.[1]

Elysia sea slugs graze on algae and some species such as E. viridis and E. chlorotica hijack the chloroplasts for themselves. The chloroplasts end up lining the slug’s digestive tract, enabling the slugs to survive solely by photosynthesis for several months at a time. This association is crucial for the development and maturing of the slug. Exactly how the slugs use the chloroplasts is unclear, as many of the proteins used are encoded in the genome of the host cell. These proteins, numbering in the hundreds, are manufactured in the cell’s nucleus, and then moved into the chloroplast, enabling it to survive.[2]

This genus was previously sometimes considered to be in the family Stiligeridae, and was also previously placed in the family Elysiiidae.

Contents

Species

Species in the genus Elysia include:[1][3]

Species brought into synonymy
  • Elysia arena Carlson & Hoff, 1978: synonym of Pattyclaya arena (Carlson & Hoff, 1978)
  • Elysia bedeckta MacFarland, 1966: synonym of Elysia hedgpethi Er. Marcus, 1961
  • Elysia cauze scops Ev. Marcus & Er. Marcus, 1967: synonym of Elysia scops Ev. Marcus & Er. Marcus, 1967
  • Elysia gracilis Risbec, 1928: synonym of Thuridilla gracilis (Risbec, 1928)
  • Elysia halimedae Macnae, 1954: synonym of Elysia pusilla (Bergh, 1871)
  • Elysia picta A. E. Verrill, 1901: synonym of Thuridilla picta (A. E. Verrill, 1901)
  • Elysia pruvotfolae Er. Marcus, 1957: synonym of Elysia crispata Mørch, 1863
  • Elysia schrammi Mörch, 1863: synonym of Elysia crispata Mørch, 1863
  • Elysia splendida Grube, 1861: synonym of Thuridilla hopei (Vérany, 1853)
  • Elysia vataae Risbec, 1928: synonym of Thuridilla vataae (Risbec, 1928)
  • Elysia verrilli Pruvot-Fol, 1946: synonym of Elysia crispata Mørch, 1863

References

  1. ^ a b c Bouchet, P.; Gofas, S. (2010). Elysia Risso, 1818. In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=137928 on 2010-12-14
  2. ^ BBC News item
  3. ^ "Elysia". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=77938.
  4. ^ Wagele, H., Stemmer, K., Burghardt, I., & Handeler, K. (2010). "Two new sacoglossan sea slug species (Opisthobranchia, Gastropoda): Ercolania annelyleorum sp. nov. (Limapontioidea) and Elysia asbecki sp. nov. (Plakobranchoidea), with notes on anatomy, histology and biology." Zootaxa 2676 (2010): 1-28.
  5. ^ Händeler K., Grzymbowski Y. P., Krug P. J. & Wägele H. (2009) "Functional chloroplasts in metazoan cells - a unique evolutionary strategy in animal life". Frontiers in Zoology 6: 28. doi:10.1186/1742-9994-6-28.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!