Molecular Biology and Genetics

Molecular Biology

Barcode data: Grammia incorrupta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAGTTTGAGCAGGAATAGTAGGAACATCTTTAAGATTGTTAATTCGAGCTGAATTAGGAAACCCTGGATCTCTTATTGGTGACGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCACTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCCAATATTGCTCACGGAGGAAGATCTGTTGATTTAGCTATTTTCTCCCTCCATTTAGCGGGAATTTCCTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAACATACGATTAAATAATTTATCATTTGATCAAATACCTCTATTTGTTTGAGCAGTTGGAATTACAGCTTTCTTACTCCTTCTCTCTCTCCCAGTTTTAGCCGGGGCCATCACTATATTATTAACAGACCGAAATTTAAATACATCTTTTTTTGACCCTGCGGGAGGAGGAGATCCAATCCTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Grammia incorrupta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grammia incorrupta

Grammia incorrupta is an arctiine moth in the family Erebidae,[1] described by H. Edwards in 1881. It is found from southern Colorado and south-eastern Kansas south through Arizona, New Mexico and western Texas into Mexico and west to south-eastern California. The habitat consists of grasslands and open woodlands.

The length of the forewings is about 18.6 mm. The hindwings are pink to yellowish pink. There are two generations per year with adults on wing from late April to early October.[2]

The larvae feed on a wide range of herbaceous, flowering plants, including Fallugia paradoxa.[3][4]

Recent research[5] has shown that the larvae of Grammia incorrupta consume alkaloid-laden leaves that help fight off internal parasitic fly larvae. This phenomenon is said to be "the first clear demonstration of self-medication among insects".

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!