Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemaris aksana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TACTTTATACTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCACATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGACTTGTACCTCTAATATTAGGTGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCATCTTTAACCCTTCTTATTTCTAGAAGTATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTATCCCCCTTTATCAGCTAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCCTCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemaris aksana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hemaris aksana

The Atlas Bee Hawkmoth (Hemaris aksana) is a moth of the Sphingidae family. It is known from the Middle and High Atlas Mountains of Morocco.[2] The habitat consists of flower-rich meadows between 1,300 and 2,500 meters.

The wingspan is 44-51 mm. It is a diurnal species. Although mimicking a bumble bee in coloration, its flight is much more rapid and agile. Adults are on wing in March, June and August. At higher altitude, the flight period is the latter half of May or June. Here, there is generally one generation per year, although a partial second generation may occur in August.

The larvae have been recorded feeding on Scabiosa species.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!