Molecular Biology and Genetics

Molecular Biology

Barcode data: Arachnis picta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCGGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCAGAATTAGGAAATCCGGGATCCTTAATTGGTGATGATCAAATCTACAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGGGGATTTGGTAATTGATTAGTCCCCTTAATGTTGGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGGTGAACAGTTTACCCCCCACTTTCCTCTAATATTGCTCATGGTGGTAGTTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCCTCAATTTTAGGAGCCATTAACTTTATTACTACAATTATTAACATACGATTAAATAACATATCATTTGACCAAATACCTTTATTTGTTTGGGCAGTAGGTATTACAGCTTTTCTTCTTCTTCTCTCCCTTCCAGTCTTAGCAGGTGCCATTACCATACTTTTAACAGATCGAAATTTAAACACATCATTTTTTGACCCAGCTGGTGGGGGAGATCCCATCCTCTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Arachnis picta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arachnis picta

Arachnis picta, commonly known as the Painted Tiger Moth,[1] is a moth of the Arctiidae family. It is found in the South-Western United States and the bordering parts of Mexico.

The wingspan is about 50 mm. The moth flies during the summer.

The larvae feed on herbaceous plants, such as Lupinus,[2] Radish and Acanthus species.

Subspecies[edit]

References[edit]

  1. ^ "Arachnis picta". Butterflies and moths of North America. Montana State University. Retrieved 2009-02-25. 
  2. ^ Holland, William (1905). The Moth Book. New York: Doubleday, Page & Co. p. 124. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!