Overview

Comprehensive Description

General Description

A medium-size (3-4 cm wingspan) white moth. The costa of the forewing is broadly buff-yellow almost to the apex. The the head and front of the thorax are the same color. The body is mostly yellow-orange, with black spots on the dorsal and lateral surfaces. Male antennae narrowly bipectinate, female simple. Sexes similar. No other Alberta moths are white with a yellow costa. The Larvae are covered in soft dense grey or whitish hair.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Throughout the USA and north into southern Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

In Alberta found in dry open and sandy habitats in the Grasslands region along the lower Red Deer and South Saskatchewan River valleys.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Adults are nocturnal and come to light, but can also be found during the day on the host plants. Larval hosts include both dogbane (Apocynum) and less commonly milkweeds (Asclepias). Larvae feed at night, in small groups of 5-7 larvae in the early instars (Cohen and Brower, 1983). The pupa is covered in a cocoon of the same hair. Adults have been collected in mid June in Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cycnia tenera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNTNTNTTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGGAATCCCGGGTCTTTAATTGGCGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATCGGAGGATTTGGTAATTGATTAGTACCTCTTATATTAGGGGCCCCAGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTACCCCCCTCATTAACATTATTAATTTCGAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGTGGTAGATCTGTAGATTTAGCTATTTTCTCTCTTCATTTAGCTGGTATTTCCTCAATTTTAGGAGCCATTAACTTTATTACTACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTATGGGCTGTAGGAATTACTGCATTTTTATTATTACTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGGGGAGGAGANCCNATTCNTTATCNNCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cycnia tenera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cycnia tenera

Cycnia tenera, the dogbane tiger moth or delicate cycnia, is a moth in the family Arctiidae. It occurs throughout North America, from southern British Columbia to Nova Scotia southwards to Arizona and Florida.

Ecology[edit]

It is a common feeder on Apocynum cannabinum (dogbane, Indian hemp) which produces a milky latex containing cardenolides, toxic cardiac glycoside that defend against herbivores.[1] It also feeds on milkweed species, Asclepias, at least in parts of its range, but is most commonly reported from dogbane. Its interactions with bats have been much studied, but are an area of dispute regarding whether the clicks emitted by adult moths are disruptive of bat echolocation, or merely aposematic warning signals. The two functions are not mutually exclusive, however, so it may not be possible to resolve the issue. The moth's coloration appears to be aposematic for insectivorous birds.[2] Chemical signals do not prevent bats from attacking, but do cause bats to release C. tenera they have caught.[2]

Life cycle[edit]

Dogbane tiger moth larva

This moth has several generations per year through much of its range, so caterpillars may be found from June to November.[3]

Eggs are laid in clutches of 50–100. Larvae are reported to feed in aggregations of five to seven, at least in the early instars.[1] Caterpillars are covered all over in soft grey to whitish hairs. Larvae feed at night.

Dogbane tiger moth cocoon

The cocoon is grayish and covered in hairs from the caterpillar's body.

Adults have white wings with a buttery yellow margin along the front of the forewing; the legs are black. The underside of the forewing may have a dusting of black. The body is yellow with a row of black spots. The wingspan is 30–40 millimetres (1.2–1.6 in).

Ultrasound calls[edit]

Bats refuse to eat either muted or intact moths of C. tenera.[2] Hawking bats, that is, those seeking moths in flight, attacked intact, clicking C. tenera less frequently than surgically muted (with tymbal organs destroyed) moths in experiments. Intact moths emitted calls when the hunting bats switched from search phase calls to approach phase calls.[4] In gleaning attacks, when bats attack moths perched on surfaces, bats use a different frequency of sound that these moths cannot hear,[5] and the moths do not respond until actually handled by bats. Then clicking moths were dropped more frequently than mute moths.

In a set of experiments using bats that had never been exposed to moths before, Hristov and Conner found the clicking signals helped the bats to learn which moths are distasteful, and so to avoid them.[6] They did not rule out a jamming function for the calls, however, and Ratcliffe and Fullard noted 20% of these native bats aborted attacks on the moth.[2]

The calls are additionally used by male moths to signal to female moths.[7] Like many Arctiinae, C. tenera flies all day and night, though preferentially some time after dusk. Its sense of hearing, on the other hand, is only moderately well-developed. Thus, the calls of Cycnia tenera have more of a defensive than a social function, and the aposematic role is likely to be significant.[8]

Subspecies[edit]

References[edit]

  1. ^ a b James A. Cohen & Lincoln P. Brower (1983). "Cardenolide sequestration by the dogbane tiger moth". Journal of Chemical Ecology 9 (4): 521–531. doi:10.1007/BF00990224. 
  2. ^ a b c d John M. Ratcliffe & James H. Fullard (2005). "The adaptive function of tiger moth clicks against echolocating bats: an experimental and synthetic approach". Journal of Experimental Biology 208 (24): 4689–4698. doi:10.1242/jeb.01927. PMID 16326950. 
  3. ^ David L. Wagner (2005). Caterpillars of Eastern North America: a Guide to Identification and Natural History. Princeton University Press. ISBN 978-0-691-12144-4. 
  4. ^ James H. Fullard, James A. Simmons & Prestor A. Saillant (1994). "Jamming bat echolocation: the dogbane tiger moth times its clicks to the terminal attack calls of the big brown bat Eptesicus fuscus" (PDF). Journal of Experimental Biology 194: 285–298. PMID 7964403. 
  5. ^ James H. Fullard (1979). "Behavioral analyses of auditory sensitivity in Cycnia tenera (Lepidoptera: Arctiidae)". Journal of Comparative Physiology 129 (1): 79–83. doi:10.1007/BF00679914. 
  6. ^ Nickolay I. Hristov & William E. Conner (2005). "Sound strategy: acoustic aposematism in the bat–tiger moth arms race". Naturwissenschaften 92 (4): 164–169. doi:10.1007/s00114-005-0611-7. PMID 15772807. 
  7. ^ W. E. Conner (1987). "Ultrasound: its role in the courtship of the arctiid moth, Cycnia tenera". Experientia 43 (9): 1029–1031. doi:10.1007/BF01952230. 
  8. ^ James H. Fullard & Nadia Napoleone (2001). "Diel flight periodicity and the evolution of auditory defences in the Macrolepidoptera" (PDF). Animal Behaviour 62 (2): 349–368. doi:10.1006/anbe.2001.1753. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Following Lafontaine and Schmidt (2010), the traditional Arctiidae have been transferred to the family Erebidae as a subfamily (Arctiinae), with former subfamilies such as Lithosiinae now treated as tribes. The circumscription of Arctiinae remains virtually identical to recent circumscriptions of Arctiidae, but circumscriptions of some taxa within the Arctiinae have changed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!