Overview

Brief Summary

Biology

This powerful swimmer is well known for its tendency to enter incredibly shallow water, and is often found in water only 30 centimetres deep or less, with its distinctive dorsal fin protruding from the surface of the water. It is also found near the bottom or in mid-water in deeper water, singly or in small groups (2). It feeds on a wide variety of small fish and invertebrates, including mullet, groupers, wrasses, cuttlefish, squid, shrimp (2). Blacktip reef sharks are viviparous, and therefore the embryos develop inside the mother, for about 16 months. Females generally give birth between late winter and early summer, to between two and four pups (2). However, reproductive cycles appear to vary throughout the blacktip reef shark's range, with reports of annual, biannual and biennial reproductive cycles (5). The blacktip reef shark is not an extremely dangerous species, although it is responsible for several provoked and unprovoked attacks on humans. Many are on people that are swimming or wading on reefs, presumably because they were mistaken for small prey. These sharks are more cautious when encountering divers and can usually be driven off (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This is the most commonly encountered species of shark in tropical Indo-Pacific reefs (4). Its medium-sized, streamlined body is brownish-grey, with a white underside. As its name suggests, it has brilliant black fin tips, (particularly distinctive on the first dorsal fin), which are all the more conspicuous against the adjacent white patches (4). The short snout is bluntly rounded and the eyes are almond-shaped (4). Running along the flanks is a noticeable white band (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits shallow water close inshore on coral reefs and in the intertidal zone (reef flats), near reef drop-offs and close offshore (Ref. 244, 58302). Also found in mangrove areas, moving in and out with the tide (Ref. 6871) and even in fresh water, but not in tropical lakes and rivers far from the sea (Ref. 9997). Occurs singly or in small groups (Ref. 244, 54301). Prefers fishes but also feeds on crustaceans, cephalopods and other mollusks (Ref. 6871). Viviparous (Ref. 50449). May become aggressive to spear fishers and has been reported to bite people wading in shallow water (Ref. 6871). Reported to cause poisoning (Ref. 4690). 2 to 4 young of 46 to 52 cm are born per litter (Ref. 1602). Generally marketed fresh (as fillet), may be dried, salted, smoked (Ref. 5284) or frozen (Ref. 9987). Fins are valued for shark-fin soup (Ref. 9987); liver as source of oil (Ref. 9997). This species is commonly seen in public aquaria (Ref. 54301).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Chagos, Comores, Djibouti, Eritrea, European waters (ERMS scope), Israeli part of the Mediterranean Sea - Eastern Basin, Kenya, Madagascar, Mauritius, Mozambique, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Hawaiian Islands and the Tuamoto Archipelago. Apparently rare or absent in the more easterly groups. Also eastern Mediterranean (through the Suez Canal).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Blacktip Reef Shark is a common tropical Indo-West Pacific and Central Pacific species with a range extending from Thailand to China, Japan, the Philippines, New Caledonia and northern Australia (Compagno 1984). Blacktip Reef Sharks have been reported from many Pacific Islands including: the Marshall Islands (Bonham 1960), the Solomon Islands (Blaber and Milton 1990) the Gilbert Islands, the Society Islands south to the Tuamotu Archipelago (Randall and Helfman 1973) and also the Hawaiian Islands (Randall and Helfman 1973, Compagno 1984, Taylor and Wisner 1989). The species is also present in South Africa, Mauritius, Seychelles and Madagascar to the Red Sea, Pakistan, India, Sri Lanka, Andaman and the Maldive Islands (Compagno 1984). This shark has also penetrated the eastern Mediterranean Sea, probably via the Suez Canal from the Red Sea. The Blacktip Reef Shark is commonly found in shallow waters on and near coral reefs (Randall and Helfman 1973, Compagno 1984, Last and Stevens 1994). This species is often seen in water only a few metres deep and is occasionally present in brackish waters (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Pitcairn Group north to Taiwan, south to Queensland (Australia) and New Caledonia. [No longer considered as Mediterranean immigrant -
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the western Pacific, the Indian Ocean and also in the eastern Mediterranean, which it has apparently invaded through the Suez Canal from the Red Sea (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

200 cm TL (male/unsexed; (Ref. 5578)); max. published weight: 13.6 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A small shark with a short, bluntly rounded snout, oval eyes, and narrow-cusped teeth; 2nd dorsal fin large; no interdorsal ridge (Ref. 5578). Yellow-brown above, white below; all fins conspicuous with black or dark brown tips also anterior and posterior dark edging on pectoral fins and upper lobe of caudal fin; a prominent black tip of first dorsal fin set off abruptly by a light band below it; a conspicuous dark band on flanks, extending rearward to pelvic fins (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common in reef flats, shallow lagoons and reef margins (Ref. 1602). Occurs singly or in small groups. Feeds on small fishes (including sharks, Ref. 5213) and cephalopods. Reported to cause poisoning (Ref. 4690). Generally marketed fresh (as fillet), may be dried, salted, smoked (Ref. 5284) or frozen (Ref. 9987). Fins are valued for shark-fin soup (Ref. 9987).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; amphidromous (Ref. 51243); brackish; marine; depth range 20 - 75 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Most authors agree that Blacktip Reef Sharks range from 30?50 cm at birth. Adults reach total lengths of up to 180 cm and mature between 90?110 cm (Compagno 1984, Stevens 1984, Last and Stevens 1994).

Stomach contents show the primary item of prey to be teleost fishes (Lyle 1987, Stevens 1984, Last and Stevens 1994). Prey items also include crustaceans, cephalopods and other molluscs (Stevens 1984, Lyle 1987, Last and Stevens 1994). Interestingly, the species is also reported to have consumed terrestrial and sea snakes (Lyle 1987, Lyle and Timms 1987). Lyle (1987) also reported that predation upon other elasmobranchs was rare.

Information on reproductive biology is limited and conflicting. Blacktip Reef Sharks are viviparous with a yolk sac placenta and give birth to 2?4 pups (usually four) (Compagno 1984, Lyle 1987, Last and Stevens 1994). In northern Australia mating probably occurs in January and February, with parturition occurring in November (Lyle 1987). This cycle would allow an 8?9-month gestation period, however, Compagno (1984b), Melouk (1957) and Randall and Helfman (1973) list the gestation period for this species as being possibly 16 months. Observations of Blacktip Reef Sharks at the Aldabra Atoll (Indian Ocean) showed mating to occur in October?November and parturition the following October. These animals would therefore undergo a 10?11 month gestation period (Stevens 1984b). Stevens (1984b) also noted that individuals in this area generally breed every other year, but that this may be due to competition for food in the area because of its high shark population.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 40
  Temperature range (°C): 25.709 - 26.159
  Nitrate (umol/L): 0.151 - 0.337
  Salinity (PPS): 34.818 - 35.312
  Oxygen (ml/l): 4.686 - 4.727
  Phosphate (umol/l): 0.141 - 0.245
  Silicate (umol/l): 1.409 - 3.229

Graphical representation

Depth range (m): 0.5 - 40

Temperature range (°C): 25.709 - 26.159

Nitrate (umol/L): 0.151 - 0.337

Salinity (PPS): 34.818 - 35.312

Oxygen (ml/l): 4.686 - 4.727

Phosphate (umol/l): 0.141 - 0.245

Silicate (umol/l): 1.409 - 3.229
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 75m.
Recorded at 75 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The blacktip reef shark prefers very shallow water on coral reefs, but is also found near reef drop-offs and occasionally just offshore. It is also thought to penetrate into brackish lakes, estuaries and even fresh water in some areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits the coral reefs of the Indo-Pacific Region; prefers the shallow water close inshore and in the intertidal zone (reef flats), near reef drop-offs and close offshore (Ref. 244, 58302). Also found in mangrove areas, moving in and out with the tide (Ref. 6871) and even in freshwater, but not in tropical lakes and rivers far from the sea (Ref. 9997). The young inhabit shallow lagoons (Ref. 9137). Feeds on fishes, crustaceans, cephalopods and other mollusks (Ref. 6871). May become aggressive to spear fishers and has been reported to bite people wading in shallow water (Ref. 6871).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). Litter size 2-4 pups (Ref. 244) after an 8-9 months gestation period (up to 16 months in some localities) (Ref.58048). Size at birth ranges from 33-52 cm (Ref. 244); 48-50 cm TL (Ref.58048). Distinct pairing with embrace (Ref. 205). Precopulatory and courtship involve the male closely following near the female's vent which could possibly be guided by their sense of smell (Ref. 49562, 47987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin detects thermal signals: blacktip reef shark
 

The skin of the blacktip reef shark enables it to locate prey via a gel that detects thermoelectric signals.

   
  "[T]he thermoelectric properties of an extracellular gel… from the electrosensors of sharks… develops significant voltages in response to tiny temperature gradients. This bulk property of the gel indicates that temperature can be translated into electrical information without the need for ion channels, a sensitivity that may help sharks to locate thermal fronts as feeding areas." (Brown 2003:495)
  Learn more about this functional adaptation.
  • Brown, Brandon R. 2003. Neurophysiology: Sensing temperature without ion channels. Nature. 421(6922): 495-495.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus melanopterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGCATAGTCGGAACAGCTCTTAGTCTACTAATTCGAGCTGAACTTGGACAACCTGGATCACTTTTAGGGGATGATCAGATTTATAATGTAATCGTAACCGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTTCCCCTAATAATTGGTGCACCAGACATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTCCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAGAAGCCGGAGCAGGTACTGGCTGAACGGTGTATCCACCGTTAGCTAGCAACTTAGCACATGCTGGACCGTCTGTTGATTTAGCTATTTTTTCTCTTCACTTAGCTGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATTACAACCATTATTAACATAAAACCACCAGCCATTTCCCAGTATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTACTTCTCCTTTCACTTCCAGTTCTTGCAGCAGGGATTACTATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGATCCTGCAGGGGGAGGAGATCCAATCCTTTATCAACACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus melanopterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Heupel, M.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Blacktip Reef Shark (Carcharhinus melanopterus) is a common and wide-ranging species, regularly caught by inshore fisheries. Globally, populations are not considered to be in immediate danger of significant depletion. However, this species is currently fished, and due to small litter sizes and long gestation periods, is vulnerable to depletion.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk/near threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Common in tropical and subtropical waters.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The Blacktip Reef Shark is not a target of major fisheries, but is regularly caught by inshore fisheries in India and Thailand (Compagno 1984b). It is rarely taken by northern Australian gillnet fisheries because of its shallow habitat (Last and Stevens 1994). Although this species is used fresh and dry salted for human consumption and for its liver-oil (Last and Stevens 1994) it is considered to be of little commercial importance (Lyle 1987). Data concerning the take of this species in artisanal fisheries is scarce, but due to its inshore, shallow water habitat it is likely to be a target of such activities. However, it is common in tropical and subtropical waters and not, therefore, considered to be in any immediate danger of serious population depletion worldwide.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The blacktip reef shark is regularly caught by inshore fisheries in many parts of its range, (2). It is caught for human consumption, fishmeal, and their fins enter the oriental sharkfin trade, for sharkfin soup. Their livers are also sought as a rich source of oil (6). In Indonesia, it forms part of the catch of sharks, rays and skates, which has increased dramatically from 1,000 tonnes in 1950 to 95,600 tonnes in 1997 (7). It is also fished off India and Thailand (2), and in the western Indian Ocean, where it is caught on longlines and in gill nets (6). In northern Australia it is occasionally caught and eaten by some Aboriginal communities (8). Due to such extensive exploitation, it is thought that blacktip reef shark populations are likely to be depleted (4). It is possible that the blacktip reef shark may also be impacted by the destruction of coral reefs (4). It is estimated that 20 percent of the world's coral reefs have already been effectively destroyed and show no immediate prospects of recovery, and 24 percent of the world's reefs are under imminent risk of collapse. This is the result of numerous human activities that cause an increase in sediment, nutrients and pollutants to enter the oceans and stress the fragile reef ecosystems (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are currently no conservation or management plans in effect for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

At present there are no known conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blacktip reef shark

Not to be confused with the blacktip shark, Carcharhinus limbatus.

The blacktip reef shark (Carcharhinus melanopterus) is a species of requiem shark, family Carcharhinidae, easily identified by the prominent black tips on its fins (especially on the first dorsal fin and the caudal fin). Among the most abundant sharks inhabiting the tropical coral reefs of the Indian and Pacific Oceans, this species prefers shallow, inshore waters, and its exposed first dorsal fin is a common sight in the region. Most blacktip reef sharks are found over reef ledges and sandy flats, though they have also been known to enter brackish and freshwater environments. This species typically attains a length of 1.6 m (5.2 ft).

Blacktip reef sharks have extremely small home ranges and exhibit strong site fidelity, remaining within same local area for up to several years at a time. They are active predators of small bony fishes, cephalopods, and crustaceans, and have also been known to feed on sea snakes and seabirds. Accounts of the blacktip reef shark's life history have been variable and sometimes contradictory, in part reflecting geographical differences within the species. Like other members of its family, this shark is viviparous with females giving birth to two to five young on a biennial, annual, or possibly biannual cycle. Reports of the gestation period range from 7–9, to 10–11, to possibly 16 months. Mating is preceded by the male following closely behind the female, likely attracted by her chemical signals. Newborn sharks are found further inshore and in shallower water than adults, frequently roaming in large groups over areas flooded by high tide.

Timid and skittish, the blacktip reef shark is difficult to approach and seldom poses a danger to humans unless roused by food. However, people wading through shallow water are at risk of having their legs mistakenly bitten. This shark is used for its meat, fins, and liver oil, but is not considered to be a commercially significant species. The International Union for Conservation of Nature has assessed the blacktip reef shark as Near Threatened. Although the species as a whole remains widespread and relatively common, overfishing of this slow-reproducing shark has led to its decline at a number of locales.

Contents

Taxonomy [edit]

View from above of a brown shark with a rounded snout, swimming over algae-covered rocks
A blacktip reef shark in the Solomon Islands

French naturalists Jean René Constant Quoy and Joseph Paul Gaimard originally described the blacktip reef shark during the 1817–1820 exploratory voyage of the corvette Uranie. In 1824, their account was published as part of Voyage autour du monde...sur les corvettes de S.M. l'Uranie et la Physicienne, Louis de Freycinet's 13-volume report on the voyage. The type specimen was a 59 cm (23 in)-long juvenile male caught off the island of Waigeo, west of New Guinea.[2] Quoy and Gaimard chose the name Carcharias melanopterus, from the Greek melas meaning "black" and pteron meaning "fin" or "wing", in reference to this shark's prominent fin markings.[3]

Subsequent authors moved the blacktip reef shark to the genus Carcharhinus; in 1965 the International Commission on Zoological Nomenclature designated it as the type species for the genus.[2] In some earlier literature, the scientific name of this shark was mistakenly given as C. spallanzani, now recognized as a synonym of the spottail shark (C. sorrah).[4] Other common names for this species include blackfin reef shark, black-finned shark, blacktip shark, reef blacktip shark, and guliman.[5]

Phylogeny [edit]

Like most other members of its genus, the phylogenetic position of the blacktip reef shark remains indeterminate. Based on morphology, Jack Garrick proposed in 1982 that the closest relative of the blacktip reef shark is the nervous shark (C. cautus).[6] Leonard Compagno's 1988 morphological analysis suggested affinity not only between this species and the nervous shark, but also four other species, and could not resolve their relationships further. A 1998 allozyme analysis by Gavin Naylor again yielded ambiguous results, finding that the blacktip reef shark forms a polytomy (irresolvable group) with 10 other Carcharhinus species.[7]

Distribution and habitat [edit]

A small shark swimming over a sandy flat with reef rocks in the background and the water surface above
The blacktip reef shark prefers shallow, inshore waters.

The blacktip reef shark is found throughout nearshore waters of the tropical and subtropical Indo-Pacific.[4] In the Indian Ocean, it occurs from South Africa to the Red Sea, including Madagascar, Mauritius, and the Seychelles, and from there eastward along the coast of the Indian Subcontinent to Southeast Asia, including Sri Lanka, the Andaman Islands, and the Maldives. In the Pacific Ocean, it is found from southern China and the Philippines to Indonesia, northern Australia and New Caledonia, and also inhabits numerous oceanic islands, including the Marshall, Gilbert, Society, and Hawaiian Islands and Tuamotu.[8] Contrary to what most sources state, there are no confirmed records of this species from Japanese waters, and purported Japanese specimens likely came from Taiwan.[9] A Lessepsian migrant, this shark has colonized the eastern Mediterranean Sea by way of the Suez Canal.[8]

Although it has been reported from a depth of 75 m (246 ft),[5] the blacktip reef shark is usually found in water only a few meters deep, and can often be seen swimming close to shore with its dorsal fin exposed.[2] Younger sharks prefer shallow, sandy flats, while older sharks are most common around reef ledges and can also be found near reef drop-offs. This species has also been reported from brackish estuaries and lakes in Madagascar, and freshwater environments in Malaysia, though it is not able to tolerate low salinity to the same degree as the bull shark (C. leucas).[2] At Aldabra in the Indian Ocean, blacktip reef sharks congregate in the channels between reef flats during low tide and travel to the mangroves when the water rises.[10] There is equivocal evidence that sharks from the northern and southern extremes of its distribution are migratory.[2]

Description [edit]

A shark with a blunt snout and obvious black tips on its pectoral and dorsal fins, against a plain dark background
The black tip with a light border on the first dorsal fin is a key identifying trait of this shark.

A robustly built species with a streamlined "typical shark" form, the blacktip reef shark has a short, wide, rounded snout and moderately large, oval eyes. Each nostril has a flap of skin in front that is expanded into a nipple-shaped lobe. Not counting small symphysial (central) teeth, the tooth rows number 11–13 (usually 12) on either side of the upper jaw and 10–12 (usually 11) on either side of the lower jaw. The upper teeth are upright to angled and narrowly triangular in shape, bearing serrations that are more coarse on the bases; the lower teeth are similar, but more finely serrated.[2][4] The teeth of adult males are more abruptly curved than those of females.[11]

The pectoral fins are large and narrowly falcate (sickle-shaped), tapering to points. The sizable first dorsal fin is high with a curving "S"-shaped rear margin, and originates over the free rear tips of the pectoral fins. The second dorsal fin is relatively large with a short rear margin, and is placed opposite the anal fin. There is no ridge between the dorsal fins. This shark is a pale grayish-brown above and white below, with an obvious white band on the sides extending forward from above the anal fin. All the fins have black tips highlighted by lighter-colored borders, which are especially striking on the first dorsal fin and lower caudal fin lobe. Most blacktip reef sharks are no more than 1.6 m (5.2 ft) long, though rarely individuals may reach 1.8 m (5.9 ft) or possibly 2.0 m (6.6 ft).[2] The maximum weight on record is 13.6 kg (30 lb).[5]

Biology and ecology [edit]

A shark swimming parallel to a reef ledge in the foreground, with many smaller fish nearby
Adult blacktip reef sharks are often found patrolling reef ledges.

Along with the grey reef shark (C. amblyrhinchos) and the whitetip reef shark (Triaenodon obesus), the blacktip reef shark is one of the three most common sharks inhabiting coral reefs in the Indo-Pacific. This species predominates in shallow habitats, while the other two are mostly found deeper. Fast-swimming and active, the blacktip reef shark may be encountered alone or in small groups; large "social" aggregations have also been observed.[2][12] For the most part, juvenile and adult sharks are not segregated by sex, save for the movements of pregnant females to give birth. Individuals exhibit strong fidelity to particular areas, where they may remain for several years.[13]

A tracking study off Palmyra Atoll in the central Pacific has found the blacktip reef shark has a home range of around 0.55 km2 (0.21 sq mi), among the smallest of any shark species. The size and location of the range does not change with time of day. Within this range, 3–17% of the area constitute favored hunting patches that are disproportionately occupied by the resident shark. The sharks spend most of their time swimming back and forth along reef ledges, making occasional short forays onto sandy flats. Their average swimming speed decreases when the tide rises at night, possibly because the influx of cooler water reduces their metabolism, or the accompanying movement of prey fishes makes foraging easier.[14] Blacktip reef sharks at Aldabra tend to be more mobile than those at Palmyra, with recorded individual movements of up to 2.5 km (1.6 mi) over 7 hours.[10]

Blacktip reef sharks, particularly small individuals, fall prey to larger fishes, including groupers, grey reef sharks, tiger sharks (Galeocerdo cuvier), and members of their own species. At Palmyra Atoll, adults avoid patrolling tiger sharks by staying out of the central, deeper lagoon.[14] Their known parasites include the tapeworms Anthobothrium lesteri,[15] Nybelinia queenslandensis,[16] Otobothrium alexanderi,[17] and Platybothrium jondoeorum,[18] a myxosporidian in the genus Unicapsula,[19] and the monogenean Dermophthirius melanopteri.[20] One of the few documented examples of infectious disease in a shark was a fatal case of hemorrhagic septicemia in a blacktip reef shark, caused by the bacterium Aeromonas salmonicida subsp. salmonicida.[21]

Feeding [edit]

Many black-tipped dorsal fins visible above churning water, and a small fish mid-jump at the upper center
The primary food of the blacktip reef shark is small fish, such as mullet.

As often the most abundant apex predator within its ecosystem, the blacktip reef shark plays a major role in structuring inshore ecological communities.[13] Its diet is composed primarily of small teleost fishes, including mullet, groupers, grunters, jacks, mojarras, wrasses, surgeonfish, and smelt-whitings. Groups of blacktip reef sharks in the Indian Ocean have been observed herding schools of mullet against the shore for easier feeding.[22] Squid, octopus, cuttlefish, shrimp, and mantis shrimp are also taken, as well as carrion and smaller sharks and rays, though this is rare.[2][8] Off northern Australia, this species is known to consume sea snakes, including Acrochordus granulatus, Hydrelaps darwiniensis, Hydrophis spp. and Lapemis hardwickii.[23] Sharks off Palmyra Atoll have been documented preying on seabird chicks that have fallen out of their nests into the water.[13] Miscellaneous items that have been found inside the stomachs of this species include algae, turtle grass, coral, hydrozoa, bryozoa, rats, and stones.[10][13]

Researchers working at Enewetak Atoll in the Marshall Islands have found the blacktip reef shark can be readily attracted by splashing or striking metal tools against hard objects underwater, as well as by the scent of both healthy and injured fish.[24] As with most sharks, the blacktip reef shark does not have any cone cells in its retina, limiting its ability to discriminate colors and fine details. Instead, its vision is adapted for sensitivity to movement or contrast under low light conditions, which is further enhanced by the presence of a reflective tapetum lucidum. Experiments have shown this shark is capable of detecting small objects up to 1.5–3 m (5–10 ft) away, but is unable to clearly discern the shape of the object.[10][25] Electroreception is another means by which this shark can locate prey; its ampullae of Lorenzini have a sensitivity of approximately 4 nV/cm and an effective range of 25 cm (10 in).[26] Similar to the grey reef shark, this species becomes more excited and "confident" in the presence of other individuals of its species, and in extreme situations can be roused into a feeding frenzy.[24] Feeding activity may be greater at night than during the day.[10]

Life history [edit]

Two sharks swimming in the same direction, one behind the other, in front of a massive coral head and a bed of boulders
Blacktip reef sharks follow each other as a prelude to mating.

Like the other members of its family, the blacktip reef shark is viviparous, though the details of its life history vary across its range. Its reproductive cycle is annual off northern Australia, with mating taking place from January to February,[27] as well as off Moorea in French Polynesia, where mating occurs from November to March.[28] The cycle is biennial off Aldabra, where intense competition within and between species for food may constrain females to only bearing young every other year.[10] Earlier accounts from the Indian Ocean by Johnson (1978), Madagascar by Fourmanoir (1961), and the Red Sea by Gohar and Mazhar (1964), indicated a biannual cycle in these regions with two breeding seasons per year from June to July and December to January.[28][29][30] If accurate, the shorter reproductive cycles of these subpopulations may be a consequence of warmer water.[28]

When receptive to mating, a female blacktip reef shark swims slowly in a sinusoidal pattern near the bottom with her head pointed down; observations in the wild suggest female sharks release chemical signals that allow males to track them. Once the male finds her, he closes to around 15 cm (5.9 in) and follows her with his snout oriented towards her vent.[31] A courting male may also bite the female behind her gills or on her pectoral fins; these mating wounds heal completely after 4–6 weeks.[28] After a period of synchronous swimming, the male pushes the female on her side and positions her so her head is against the bottom and her tail is raised. Once the female is in position, the male inserts one of his claspers into her cloaca. Copulation lasts for several minutes, after which the sharks separate and resume their regular behaviors.[31] Off Moorea, individual older females mate and give birth at a consistent time every year, often to within a week's precision, whereas younger females exhibit more variability in their timing. Younger females are also more likely to fail to become pregnant after mating.[28]

An expanse of clear water and white sand, and several sharks swimming with their black-tipped dorsal fins protruding above the water
Young blacktip reef sharks frequent very shallow, sandy flats.

The gestation period has been reported as 10–11 months long in the Indian Ocean and Pacific islands,[10][28] and 7–9 months long off northern Australia.[27] Earlier authors, such as Melouk (1957), have estimated a gestation period as long as 16 months, though the validity of this figure has subsequently been challenged.[28] The female has a single functional ovary (on the right) and two functional uteruses, divided into separate compartments for each embryo. Newly ovulated egg cases measure 3.9 cm (1.5 in) by 2.6 cm (1.0 in); after hatching the embryos are sustained by a yolk sac during the first stage of development. After two months, the embryo measures 4 cm (1.6 in) long and has well-developed external gills. After four months, the yolk sac has begun to be converted into a placental connection that attaches to the uterine wall; at this time, the embryo's dark fin markings develop. By five months, the embryo measures 24 cm (9.4 in) and has resorbed its external gills; the placenta is fully formed, though some yolk remains until seven months into gestation.[10]

Parturition occurs from September to November, with females making use of shallow nursery areas interior of the reef.[14][27][28] Newborn pups measure 40–50 cm (16–20 in) long in the Indian Ocean and off northern Australia, while free-swimming pups as small as 33 cm (13 in) long have been observed in the Pacific islands.[13][32] The litter size is 2–5 (typically 4), and is not correlated with female size.[8][10] Young blacktip reef sharks commonly form large groups in water barely deep enough to cover their bodies, over sand flats or in mangrove swamps close to shore. During high tide, they also move onto flooded coral platforms or seaweed beds.[14][24][33] Growth is initially rapid; one documented captive shark grew an average of 23 cm (9.1 in) per year in its first two years of life.[34] The growth rate slows to around 5 cm (2.0 in) per year in juveniles and adults.[14] Males and females mature sexually at lengths of 95 cm (37 in) and 97 cm (38 in) respectively off northern Australia,[27] and 105 cm (41 in) and 110 cm (43 in), respectively, off Aldabra.[10] Males mature at 97 cm (38 in) long off Palmyra Atoll.[14]

Human interactions [edit]

A snorkeler on the left looks at a small nearby shark, which is swimming away
Submerged swimmers are less likely to be bitten by the blacktip reef shark than waders.

Under most circumstances, the blacktip reef shark has a timid demeanor and is easily frightened away by swimmers. However, its inshore habitat preferences bring it into frequent contact with humans, and thus it is regarded as potentially dangerous.[2] As of early 2009, 11 unprovoked attacks and 21 attacks total (none fatal) were listed on the International Shark Attack File that are attributable to the blacktip reef shark.[35] Most attacks involve sharks biting the legs or feet of waders, apparently mistaking them for their natural prey, and do not result in serious injury.[2] In the Marshall Islands, native islanders avoid blacktip reef shark attacks by swimming rather than wading through shallow water, and a way of discouraging these sharks is to submerge one's body. The blacktip reef shark has also been known to become aggressive in the presence of bait, and may pose a threat while attempting to steal the catches of spear fishers.[2]

The blacktip reef shark is a regular catch of coastal fisheries, such as those operating off Thailand and India, but is not targeted or considered commercially important.[8] The meat (sold fresh, frozen, dried and salted, or smoked for human consumption), liver oil, and fins are used.[5] The International Union for Conservation of Nature has assessed the blacktip reef shark as Near Threatened. Though it remains widespread and common overall, substantial local declines due to overfishing have now been documented in many areas. This species has a low reproductive rate, limiting its capacity for recovering from depletion.[8][13] Blacktip reef sharks are popular subjects of public aquarium exhibits, because of their "sharky" appearance and modest size, and are also attractions for ecotourism divers.[9][11]

References [edit]

  1. ^ Heupel, M. (2005). Carcharhinus melanopterus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved September 15, 2009.
  2. ^ a b c d e f g h i j k l Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 487–489. ISBN 92-5-101384-5. 
  3. ^ Nouguier, J. and D. Refait (1990). Poissons de l'Océan Indien, les îles Maldives. Réalisations Éditoriales Pédagogiques. p. 27. 
  4. ^ a b c Randall, J.E. and J.P. Hoover (1995). Coastal Fishes of Oman. University of Hawaii Press. p. 33. ISBN 0-8248-1808-3. 
  5. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus melanopterus" in FishBase. September 2009 version.
  6. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS CIRC–445.
  7. ^ Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8 (4): 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. 
  8. ^ a b c d e f Fowler, S.L., R.D. Cavanagh, M. Camhi, G.H. Burgess, G.M. Cailliet, S.V. Fordham, C.A. Simpfendorfer, and J.A. Musick (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 296–297. ISBN 2-8317-0700-5. 
  9. ^ a b Yano, K. and J.F. Morrissey (May 25, 1999). "Confirmation of blacktip shark, Carcharhinus limbatus, in the Ryukyu Islands and notes on possible absence of C. melanopterus in Japanese waters". Ichthyological Research 46 (2): 193–198. doi:10.1007/BF02675438. 
  10. ^ a b c d e f g h i j Stevens, J. D. (1984). "Life history and ecology of sharks at Aldabra Atoll, Indian Ocean". Proceedings of the Royal Society of London B 222 (1226): 79–106. doi:10.1098/rspb.1984.0050. 
  11. ^ a b Press, M. Biological Profiles: Blacktip Reef Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on October 3, 2009.
  12. ^ Springer, S. (1967). "Social organization of shark populations". In Gilbert, P.W. and R.F. Mathewson and D.P. Rail. Sharks, Skates, and Rays. Baltimore: Johns Hopkins Press. pp. 149–174. 
  13. ^ a b c d e f Papastamatiou, Y.P., J.E. Caselle, A.M. Friedlander and C.G. Lowe (September 16, 2009). "Distribution, size frequency, and sex ratios of blacktip reef sharks Carcharhinus melanopterus at Palmyra Atoll: a predator-dominated ecosystem". Journal of Fish Biology 75 (3): 647–654. doi:10.1111/j.1095-8649.2009.02329.x. PMID 20738562. 
  14. ^ a b c d e f Papastamatiou, Y.P., C.G. Lowe, J.E. Caselle and A.M. Friedlander (April 2009). "Scale-dependent effects of habitat on movements and path structure of reef sharks at a predator-dominated atoll". Ecology 90 (4): 996–1008. doi:10.1890/08-0491.1. PMID 19449694. 
  15. ^ Williams, H.H., M.D.B. Burt, and J.N. Caira (November 2004). "Anthobothrium lesteri n. sp. (Cestoda: Tetraphyllidea) in Carcharhinus melanopterus from Heron Island, Australia, with comments on its site, mode of attachment, reproductive strategy and membership of the genus". Systematic Parasitology 59 (3): 211–221. doi:10.1023/B:SYPA.0000048100.77351.9f. PMID 15542950. 
  16. ^ Jones, M.K. and I. Beveridge (1998). "Nybelinia queenslandensis sp. n. (Cestoda: Trypanorhyncha) parasitic in Carcharhinus melanopterus, from Australia, with observations on the fine structure of the scolex including the rhyncheal system". Folia Parasitologica 45 (4): 295–311. 
  17. ^ Palm, H.W. (2004). The Trypanorhyncha Diesing 1863. PKSPL-IPB Press. pp. 1–710. ISBN 979-9336-39-2. 
  18. ^ Healy, C.J. (October 2003). "A revision of Platybothrium Linton, 1890 (Tetraphyllidea: Onchobothriidae), with a phylogenetic analysis and comments on host-parasite associations". Systematic Parasitology 56 (2): 85–139. doi:10.1023/A:1026135528505. PMID 14574090. 
  19. ^ Stoffregen, D.A. and W.I. Anderson (1990). "A myxosporidian parasite in the skeletal muscle of a black-tip reef shark, Carcharhinus melanopterus (Quoy & Gaimard, 1824)". Journal of Fish Diseases 13 (6): 549–552. doi:10.1111/j.1365-2761.1990.tb00817.x. 
  20. ^ Cheung, P.J., R.F. Nigrelli, G.D. Ruggieri, and G.L. Crow (1988). "A new microbothriid (monogenean) causing skin lesions on the Pacific blacktip reef shark, Carcharhinus melanopterus (Quoy and Gaimard)". Journal of Aquariculture & Aquatic Sciences 5 (2): 21–25. 
  21. ^ Briones, V., A. Fernandez, M. Blanco, M.L. de Vicente, J. Garcia, J.K. Mendez and J. Goyache (September 1998). "Haemorrhagic septicaemia by Aeromonas salmonicida subsp. salmonicida in a black-tip reef shark (Carcharhinus melanopterus)". Journal of Veterinary Medicine Series B 45 (7): 443–445. doi:10.1111/j.1439-0450.1998.tb00814.x. PMID 9780832. 
  22. ^ Eibl-Eibesfeldt, I. and H. Hass (1959). "Erfahrungen mit Haien". Zeit Tierpsychologie 16 (6): 733–746. 
  23. ^ Lyle, J.M. and G.J. Timms (1987). "Predation on aquatic snakes by sharks from northern Australia". Copeia (American Society of Ichthyologists and Herpetologists) 1987 (3): 802–803. doi:10.2307/1445681. JSTOR 1445681. 
  24. ^ a b c Hobson, E.S. (1963). "Feeding behavior in three species of sharks". Pacific Science 17: 171–193. 
  25. ^ Tester, A.L. and S. Kato (1966). "Visual target discrimination in blacktip sharks (Carcharhinus melanopterus) and grey sharks (C. menisorrah)". Pacific Science 20 (4): 461–471. 
  26. ^ Haine, O.S., P.V. Ridd and R.J. Rowe (2001). "Range of electrosensory detection of prey by Carcharhinus melanopterus and Himantura granulata". Marine and Freshwater Research 52 (3): 291–296. doi:10.1071/MF00036. 
  27. ^ a b c d Lyle, J.M. (1987). "Observations on the Biology of Carcharhinus cautus (Whitley), C. melanopterus (Quoy & Gainard) and C. fitzroyensis (Whitley) from Northern Australia". Australian Journal of Marine & Freshwater Research 38 (6): 701–710. doi:10.1071/MF9870701. 
  28. ^ a b c d e f g h Porcher, I.F. (April 2005). "On the gestation period of the blackfin reef shark, Carcharhinus melanopterus, in waters off Moorea, French Polynesia". Marine Biology 146 (6): 1207–1211. doi:10.1007/s00227-004-1518-0. 
  29. ^ Fourmanoir, P. (1961). "Requins de la cote ouest de Madagascar". Memoires de l'Institut Scientifique de Madagascar Serie F 4: 1–81. 
  30. ^ Gohar, H. A. F. and F.M. Mazhar (I964). "The elasmobranchs of the north-western Red Sea". Marine Biological Station, Ghardaqa 13. pp. 1–144. 
  31. ^ a b Johnson, R.H. and D.R. Nelson (1978). "Copulation and possible olfaction-mediated pair formation in two species of carcharhinid sharks". Copeia (American Society of Ichthyologists and Herpetologists) 1978 (3): 539–542. doi:10.2307/1443626. JSTOR 1443626. 
  32. ^ Melouk, M.A. (1957). "On the Development of Carcharhinus Melanopterus [sic] (Q. & G.)". Marine Biological Station, Ghardaqa 9: 229–251. 
  33. ^ Martin, R.A. Why Do Sharks Expose Their Dorsal Fins? ReefQuest Centre for Shark Research. Retrieved on October 3, 2009.
  34. ^ Randall, J. E. (1977). "Contributions to the biology of the whitetip reef shark (Triaenodon obesus)". Pacific Science 31 (2): 143–164. 
  35. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 18, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!